ID: 910587831

View in Genome Browser
Species Human (GRCh38)
Location 1:88898882-88898904
Sequence ACTCTTACTCAGGCGGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910587831_910587837 11 Left 910587831 1:88898882-88898904 CCATGCCCCGCCTGAGTAAGAGT No data
Right 910587837 1:88898916-88898938 TAAAGAAAGAGTTGAAATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910587831 Original CRISPR ACTCTTACTCAGGCGGGGCA TGG (reversed) Intergenic
No off target data available for this crispr