ID: 910588215

View in Genome Browser
Species Human (GRCh38)
Location 1:88901724-88901746
Sequence AATTATCTGCAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910588215_910588218 15 Left 910588215 1:88901724-88901746 CCTGCCATCTTCTGCAGATAATT No data
Right 910588218 1:88901762-88901784 GACAGCTCTTGTCTTGTTACTGG No data
910588215_910588220 25 Left 910588215 1:88901724-88901746 CCTGCCATCTTCTGCAGATAATT No data
Right 910588220 1:88901772-88901794 GTCTTGTTACTGGGCTTTAGTGG No data
910588215_910588219 16 Left 910588215 1:88901724-88901746 CCTGCCATCTTCTGCAGATAATT No data
Right 910588219 1:88901763-88901785 ACAGCTCTTGTCTTGTTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910588215 Original CRISPR AATTATCTGCAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr