ID: 910588218

View in Genome Browser
Species Human (GRCh38)
Location 1:88901762-88901784
Sequence GACAGCTCTTGTCTTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910588215_910588218 15 Left 910588215 1:88901724-88901746 CCTGCCATCTTCTGCAGATAATT No data
Right 910588218 1:88901762-88901784 GACAGCTCTTGTCTTGTTACTGG No data
910588216_910588218 11 Left 910588216 1:88901728-88901750 CCATCTTCTGCAGATAATTACTC No data
Right 910588218 1:88901762-88901784 GACAGCTCTTGTCTTGTTACTGG No data
910588214_910588218 16 Left 910588214 1:88901723-88901745 CCCTGCCATCTTCTGCAGATAAT No data
Right 910588218 1:88901762-88901784 GACAGCTCTTGTCTTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910588218 Original CRISPR GACAGCTCTTGTCTTGTTAC TGG Intergenic
No off target data available for this crispr