ID: 910590511

View in Genome Browser
Species Human (GRCh38)
Location 1:88924646-88924668
Sequence CGGCAAACAGCAGTGGTAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910590511_910590517 24 Left 910590511 1:88924646-88924668 CCGTCTACCACTGCTGTTTGCCG No data
Right 910590517 1:88924693-88924715 CCATCTCTCCAGATCCGGTAAGG No data
910590511_910590515 19 Left 910590511 1:88924646-88924668 CCGTCTACCACTGCTGTTTGCCG No data
Right 910590515 1:88924688-88924710 GACTTCCATCTCTCCAGATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910590511 Original CRISPR CGGCAAACAGCAGTGGTAGA CGG (reversed) Intergenic
No off target data available for this crispr