ID: 910590511 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:88924646-88924668 |
| Sequence | CGGCAAACAGCAGTGGTAGA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 910590511_910590517 | 24 | Left | 910590511 | 1:88924646-88924668 | CCGTCTACCACTGCTGTTTGCCG | No data | ||
| Right | 910590517 | 1:88924693-88924715 | CCATCTCTCCAGATCCGGTAAGG | No data | ||||
| 910590511_910590515 | 19 | Left | 910590511 | 1:88924646-88924668 | CCGTCTACCACTGCTGTTTGCCG | No data | ||
| Right | 910590515 | 1:88924688-88924710 | GACTTCCATCTCTCCAGATCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 910590511 | Original CRISPR | CGGCAAACAGCAGTGGTAGA CGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||