ID: 910596770

View in Genome Browser
Species Human (GRCh38)
Location 1:88989654-88989676
Sequence TAAGCTTGGAGTGCAGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910596766_910596770 27 Left 910596766 1:88989604-88989626 CCAGGAATTACATTGCATGATGG 0: 1
1: 1
2: 0
3: 7
4: 121
Right 910596770 1:88989654-88989676 TAAGCTTGGAGTGCAGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910596770 Original CRISPR TAAGCTTGGAGTGCAGCTTC TGG Intronic
No off target data available for this crispr