ID: 910602023

View in Genome Browser
Species Human (GRCh38)
Location 1:89042756-89042778
Sequence GCTCCCTGCGAGGCTGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910602020_910602023 -1 Left 910602020 1:89042734-89042756 CCAGGCACTGGCATGGGCGCTGG No data
Right 910602023 1:89042756-89042778 GCTCCCTGCGAGGCTGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910602023 Original CRISPR GCTCCCTGCGAGGCTGAAAC TGG Intergenic
No off target data available for this crispr