ID: 910603745

View in Genome Browser
Species Human (GRCh38)
Location 1:89059883-89059905
Sequence TGTATGGAAAAGACCTATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 2, 1: 0, 2: 1, 3: 11, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910603745_910603748 24 Left 910603745 1:89059883-89059905 CCAACATAGGTCTTTTCCATACA 0: 2
1: 0
2: 1
3: 11
4: 146
Right 910603748 1:89059930-89059952 GAAAATAAGTCAATTTTCTCAGG 0: 1
1: 0
2: 4
3: 42
4: 427
910603745_910603747 0 Left 910603745 1:89059883-89059905 CCAACATAGGTCTTTTCCATACA 0: 2
1: 0
2: 1
3: 11
4: 146
Right 910603747 1:89059906-89059928 TTTTAAAGATTAGAATGCTGAGG 0: 1
1: 1
2: 21
3: 324
4: 2656

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910603745 Original CRISPR TGTATGGAAAAGACCTATGT TGG (reversed) Intronic
901722876 1:11214309-11214331 TGTGTGGAAAATAACCATGTGGG - Intronic
902716157 1:18274210-18274232 TCTATGGCAAAGGCCTATGAAGG + Intronic
903463471 1:23535422-23535444 TGTATGTAAAATACCTAGCTGGG - Intergenic
905327077 1:37161077-37161099 TGGATGGAAGAGACCTATTGGGG + Intergenic
906177629 1:43789196-43789218 TGGATGGAAATGGGCTATGTTGG + Intronic
910603745 1:89059883-89059905 TGTATGGAAAAGACCTATGTTGG - Intronic
910637085 1:89420610-89420632 TGTATGGAAAAGACCTATGTTGG + Intergenic
918060424 1:181056491-181056513 TGTATGAAGACAACCTATGTAGG - Exonic
920764851 1:208822510-208822532 TGTTTAGAAAACACCTGTGTTGG + Intergenic
1063028039 10:2202261-2202283 TCTCTGGAAAAGACCTAGGGAGG + Intergenic
1065681897 10:28244582-28244604 TGTGTGGAAAGGACATATGTTGG - Intronic
1067926192 10:50510939-50510961 TGTATTGAAAAGACCCTTTTGGG + Intronic
1068418934 10:56763503-56763525 TGTATAGAAAAGACCTGAGAAGG + Intergenic
1074689269 10:115989698-115989720 TTTGTGGAAAGGCCCTATGTTGG + Intergenic
1075461871 10:122621760-122621782 GGTAAGGAAAGGACATATGTTGG + Intronic
1075856410 10:125633714-125633736 TGTTTGGAAAAGACCGTTGTTGG + Intronic
1078730303 11:13967623-13967645 TGTTTGGAAAGGACATATTTAGG + Intronic
1081468054 11:43343088-43343110 TATATGGAAAAGAATTAAGTAGG - Intronic
1081530746 11:43957540-43957562 TCTCTGGAAAAGACCTAGGAAGG + Intergenic
1082855970 11:57806910-57806932 TGTAGGGAAAAAACCTATAGAGG + Exonic
1083116062 11:60460994-60461016 TGTATGCAAAGAACCCATGTTGG - Intronic
1086478073 11:87201343-87201365 TGTATGGAAAATAAATAAGTGGG + Intronic
1086897212 11:92327168-92327190 TGGAAGAAAAAGACTTATGTAGG + Intergenic
1087348123 11:96997188-96997210 TTTATGGAAACGACCTATATTGG - Intergenic
1087543561 11:99552591-99552613 GGTATGGAAAAAACTGATGTTGG + Intronic
1093419112 12:18954185-18954207 TGTTATGAAAAGACCCATGTGGG + Intergenic
1093444001 12:19233424-19233446 TGTATGGAAAAGAGATTGGTAGG + Intronic
1094303949 12:28996975-28996997 TTTCTGGAAAATGCCTATGTGGG - Intergenic
1094333353 12:29320642-29320664 TGTAGCTAAAAGACCTAGGTTGG + Intronic
1096440072 12:51634358-51634380 TGTATGGAAAAGAATTATACAGG + Intronic
1098129862 12:67338831-67338853 GGTTTGGAGAAGACCTATTTGGG + Intergenic
1098467317 12:70802361-70802383 TATATTGAGAAGACTTATGTAGG + Intronic
1101451782 12:104786388-104786410 TGTATGAGAAACACCTAGGTAGG - Intergenic
1107161582 13:37235764-37235786 TGTATGTAAGAGACATATCTTGG + Intergenic
1107844930 13:44502003-44502025 TGAATGGAAATGAACCATGTAGG - Intronic
1110545706 13:76752767-76752789 AGTGTGGAAATGAACTATGTGGG - Intergenic
1118824821 14:69370416-69370438 TGAATGGTAAAGCCCTATGGAGG + Intergenic
1119942773 14:78658782-78658804 TGTACGGAAAAGCACTCTGTGGG + Intronic
1122633066 14:103116584-103116606 TGTAAGAGAAACACCTATGTTGG - Intergenic
1123798407 15:23797130-23797152 TTTTTGAAAAAGACCTCTGTGGG + Intergenic
1124226057 15:27896031-27896053 GGCATGGAAAAGATCTATGAAGG + Intronic
1126134217 15:45375496-45375518 TGGATGGAAGAGACTTAGGTAGG + Intronic
1126667435 15:51088074-51088096 TTTATGTAAAATGCCTATGTAGG - Intronic
1127047020 15:55036666-55036688 TGTGTGACCAAGACCTATGTAGG - Intergenic
1129465272 15:75721348-75721370 TGACTGGAAAACACCTCTGTGGG + Intergenic
1130665241 15:85863911-85863933 TGCAGGGAAAAGACCCACGTGGG - Intergenic
1131858125 15:96621374-96621396 TGGATGGAAAATACCTACTTAGG + Intergenic
1132242750 15:100271912-100271934 TGTATGCAAAAGAACAAAGTTGG - Intronic
1133927174 16:10202701-10202723 TGTAAGGTAAAGACCTATATAGG - Intergenic
1140878265 16:79173390-79173412 TGTGTGAAAGAGACCCATGTGGG - Intronic
1141140060 16:81491441-81491463 TGTGTGGGAAAGCCCTCTGTGGG + Intronic
1141252825 16:82374313-82374335 TGTATAAACAAAACCTATGTAGG + Intergenic
1143138477 17:4726047-4726069 TAAATGGAATAGACTTATGTGGG - Intergenic
1143757036 17:9074773-9074795 TGGATGCAAAAGTCCTATGCAGG + Intronic
1149433016 17:56609564-56609586 TGCATGGAAAAGGCCAAGGTGGG - Intergenic
1156838022 18:41578936-41578958 TTTATGGCAAACACCTATTTTGG - Intergenic
1157106910 18:44782541-44782563 TGTATGGAAATCATCTAGGTGGG + Intronic
1157130044 18:44998265-44998287 TGTATGGAAAACACCTGAGTGGG + Intronic
1157585073 18:48795844-48795866 TGGATGGCAAAGACTTGTGTTGG - Intronic
1158067182 18:53424807-53424829 CTTATGGCAGAGACCTATGTTGG + Intronic
1158379545 18:56913927-56913949 TGTATGGAATAGACCGTAGTGGG - Intronic
1159326974 18:66934071-66934093 TGTATAGAAAACAACTATGGCGG + Intergenic
1162495258 19:11019837-11019859 TGTAGGGGAAAGGCCTAGGTGGG + Intronic
1165303719 19:34990114-34990136 TCTGTGGAAAATACCTATTTTGG - Intergenic
1168034854 19:53711240-53711262 TGAATCCAAAAGACCTAGGTTGG - Intergenic
1168212761 19:54902709-54902731 TCTATGGAGGAGACTTATGTAGG - Intergenic
1168345146 19:55647037-55647059 AGTTTGGAAAAGACCAATCTAGG + Intronic
927804380 2:26133006-26133028 TGCATTAAAAAGACCTCTGTGGG - Intronic
928258904 2:29749381-29749403 TGTTTGTAAAAGACATAGGTTGG - Intronic
929448843 2:42022990-42023012 GGTATGGAATAGAGCTATGGAGG + Intergenic
930820380 2:55640554-55640576 TGTATTGAAATTACCTAGGTTGG - Intronic
930834219 2:55775742-55775764 TGTATGGAAATATCCTCTGTAGG + Intergenic
932038426 2:68272363-68272385 TGTATGCAAAAGACACATGGGGG - Intergenic
933017671 2:77149901-77149923 TGTATGTAAGTGAGCTATGTGGG - Intronic
936371285 2:111904275-111904297 AGTTTGGAAAAGAGTTATGTGGG - Intronic
937883294 2:126884090-126884112 TGTTTTGAAAACAACTATGTAGG - Intergenic
938155974 2:128940362-128940384 TGTATTGTATAGACGTATGTGGG - Intergenic
938465782 2:131523989-131524011 TGCTTGGAAGAGACCTAAGTGGG - Intergenic
939160355 2:138581346-138581368 TTTGTGGAAAACACATATGTTGG + Intergenic
939671793 2:145022021-145022043 TGTAGGGAAAAGCTCTGTGTGGG + Intergenic
941178009 2:162223311-162223333 TTTATGGAAAAAACATATATAGG - Intronic
943396945 2:187350983-187351005 TGTATGCATAAGAAATATGTTGG + Intronic
943588485 2:189768232-189768254 AGTACTGAAAAGACCTATCTAGG - Intergenic
943800206 2:192047808-192047830 TGTCTGGAACAGACTGATGTTGG + Intronic
944345258 2:198657304-198657326 TATTTGGAAAAGATCTATGATGG - Intergenic
945157467 2:206854594-206854616 TGTATGGATAAGACTTATGTTGG + Intergenic
945789086 2:214281101-214281123 GGTATGGACAAGATCTATGAAGG - Intronic
946266783 2:218550993-218551015 TGGATGGAAAAGACTTTTCTGGG - Intronic
947309165 2:228781424-228781446 TGTCTGAAAAAGACCTAATTTGG - Intergenic
1170792255 20:19517786-19517808 TGTAGGGAAGAGACCCAAGTGGG + Intronic
1171968700 20:31549849-31549871 AGTATAGAAAAGACCTCTGATGG - Intronic
1172070561 20:32253846-32253868 TGTATGTAATAGAAATATGTAGG - Intergenic
1174527135 20:51181792-51181814 TGTATGTAAAAGTTTTATGTTGG + Intergenic
1176168146 20:63685288-63685310 TGCATGGAGATGGCCTATGTTGG + Intronic
1176721738 21:10399149-10399171 TGTATGGAGAGGACCTGAGTTGG + Intergenic
1180302924 22:11051927-11051949 TGTATGGAGAGGACCTGAGTTGG + Intergenic
1180891248 22:19291095-19291117 TGCATTGAAAAGCCCTATTTAGG + Intronic
1182263952 22:29097819-29097841 TGTTTTGAAAAGACTTATTTAGG - Intronic
1184188857 22:42881728-42881750 AGTAGGGAAAAGTCCTTTGTTGG + Intronic
1184211481 22:43038382-43038404 TGTATGGAGAGGACCTGAGTTGG - Intergenic
950855715 3:16102804-16102826 TGGTTGGAAAAGACCTCTCTAGG - Intergenic
950896241 3:16454257-16454279 TGAATTGATAAGACCAATGTGGG - Intronic
955126612 3:56118531-56118553 TACATGGAAAAGACCTAGCTTGG - Intronic
955529712 3:59860438-59860460 TGTAGGGAAAAGAAGGATGTTGG + Intronic
955814426 3:62826880-62826902 TGTGGGGAAAAGATCTTTGTTGG + Intronic
957436525 3:80184261-80184283 TATTTGGAAAAGGCATATGTAGG + Intergenic
959451713 3:106513111-106513133 TACATGGAAAAGACATATGTAGG - Intergenic
962886965 3:139636616-139636638 TATTTGGAAAAGACCCATCTAGG - Intronic
964891995 3:161548049-161548071 TGTATGGAAAATAATTATTTTGG + Intergenic
964913301 3:161808906-161808928 TGTATAGAAAACACTTATCTTGG + Intergenic
964969687 3:162544147-162544169 TTTAAGGAAAGGATCTATGTAGG - Intergenic
966238041 3:177724646-177724668 TCTATGAAAAAGAATTATGTTGG - Intergenic
971331488 4:25685165-25685187 TGAATGGAAAATGCCTATGTAGG - Intergenic
976346102 4:84003363-84003385 TGCCTGGAAAAGACATTTGTTGG + Intergenic
977449774 4:97180204-97180226 TGTATGGAAAAGACCCATTCAGG - Intergenic
978378374 4:108099378-108099400 TGTATGGAAAAGAACTCTTATGG + Intronic
983686758 4:170419418-170419440 TGTAAGAAAAAGAACAATGTTGG + Intergenic
987334389 5:16885947-16885969 TCTATGGCAAGGACCTATGAAGG - Intronic
987982631 5:25106465-25106487 TGTATGGATAATACCTACATTGG + Intergenic
987994407 5:25256603-25256625 TTTTTGGAAAAGACCTAAGGTGG + Intergenic
988531485 5:32031214-32031236 TGTATGGAAAAGACTCTTGACGG - Intronic
989127654 5:38072782-38072804 TGTATGAAAATTACCTACGTTGG + Intergenic
992490134 5:77234641-77234663 TCTATGGAAAGGTACTATGTAGG - Intronic
992655722 5:78907786-78907808 TGTGTGGAAAATACCTATGCTGG + Intronic
1001088068 5:168715970-168715992 TGTCTGAAAAAGAAATATGTAGG - Intronic
1001302523 5:170545936-170545958 TGTATGTAAAAGAACTGTGGAGG + Intronic
1001766864 5:174256066-174256088 TGTATGGAAAATACATTTCTAGG - Intergenic
1004440712 6:15650183-15650205 TGTGTGGTAAAGATGTATGTGGG - Intronic
1006140559 6:31926861-31926883 GGTATTGAAAAGACTTCTGTGGG + Intronic
1008774264 6:55017084-55017106 TGTATTGAAAAAAACTGTGTGGG - Intergenic
1010739351 6:79481864-79481886 AGTATGGAAAATACATATTTGGG + Intergenic
1011909207 6:92414115-92414137 TTTCTGGAACAGACATATGTAGG - Intergenic
1014233636 6:118931939-118931961 TGTAAGTCAAAGAACTATGTTGG + Intronic
1014982682 6:127964065-127964087 TGTATGGAAAACAGTTATGATGG + Intergenic
1019393811 7:805701-805723 TCTAAGGAAAAGAAGTATGTTGG + Intergenic
1019928773 7:4209964-4209986 TGTATGTATATGATCTATGTAGG + Intronic
1020725029 7:11801365-11801387 TGTATGTAAAAGACTTACTTTGG - Intronic
1030516258 7:110542242-110542264 TTTATCTAAAAGACCTAAGTAGG - Intergenic
1031118409 7:117693173-117693195 TGTATAGAAAAAACGTATATAGG + Intronic
1031218700 7:118933402-118933424 TGTATGGAGAAAACCTCAGTGGG - Intergenic
1036675767 8:10831279-10831301 CGTAAGGAAAACAGCTATGTAGG + Intronic
1037211270 8:16391227-16391249 GGTATGGAAATGACCTGTGTTGG - Intronic
1039766015 8:40628844-40628866 TGTATAGTAGAGATCTATGTTGG - Intronic
1039897228 8:41725166-41725188 TGTCTGGAAAACACCTGGGTGGG - Intronic
1040462028 8:47658632-47658654 AGTATGGAAAAGGCCTTTCTCGG + Intronic
1041242830 8:55862883-55862905 TGTATGTAGAATACCTGTGTGGG - Intergenic
1047985134 8:130225292-130225314 TGTATGCAAAAGACTTTTTTGGG + Intronic
1050694711 9:8265796-8265818 TCTATGGACAAGTCCTATGTTGG + Intergenic
1051461952 9:17328697-17328719 TGTATGCAAAATGCCTCTGTTGG + Intronic
1055461743 9:76526249-76526271 TGCATAGTAAACACCTATGTGGG + Intergenic
1055786257 9:79872173-79872195 TTGATGGAAAAGACATAAGTTGG - Intergenic
1059597989 9:115744060-115744082 TGCATGGAAAAGACCCACGCAGG + Intergenic
1185809735 X:3095578-3095600 TGTAGTGAACATACCTATGTTGG - Intronic
1186408962 X:9329070-9329092 TGTATGGAAGTGACCTTTTTGGG - Intergenic
1188228221 X:27628338-27628360 TATATGGAAAAAACCCAAGTGGG - Intronic
1189582440 X:42421209-42421231 TGTTTGGAAAAGTTCCATGTGGG + Intergenic
1191882757 X:65858801-65858823 GGTATGGAAAAGACCAGTCTGGG + Intergenic
1196196909 X:112846363-112846385 TGTGTGGAAAACAGCAATGTGGG + Intergenic
1198011924 X:132565405-132565427 TGTATAGAAAAGAAATAGGTGGG + Intergenic
1198250284 X:134873367-134873389 TGGATGAAAAAAAGCTATGTGGG - Intergenic