ID: 910606218

View in Genome Browser
Species Human (GRCh38)
Location 1:89087654-89087676
Sequence TTGTAGGTACCTAAACTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910606212_910606218 26 Left 910606212 1:89087605-89087627 CCAAGTCGGCGGCTCCGCTTTCT No data
Right 910606218 1:89087654-89087676 TTGTAGGTACCTAAACTGGAAGG No data
910606215_910606218 12 Left 910606215 1:89087619-89087641 CCGCTTTCTTGGTGGATGACAAC No data
Right 910606218 1:89087654-89087676 TTGTAGGTACCTAAACTGGAAGG No data
910606211_910606218 27 Left 910606211 1:89087604-89087626 CCCAAGTCGGCGGCTCCGCTTTC No data
Right 910606218 1:89087654-89087676 TTGTAGGTACCTAAACTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910606218 Original CRISPR TTGTAGGTACCTAAACTGGA AGG Intergenic
No off target data available for this crispr