ID: 910610056

View in Genome Browser
Species Human (GRCh38)
Location 1:89131565-89131587
Sequence ATGTGGAAATGCTAGATCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 564
Summary {0: 1, 1: 0, 2: 8, 3: 74, 4: 481}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910610054_910610056 21 Left 910610054 1:89131521-89131543 CCATTTTCAATTTGAGTAAATCA 0: 1
1: 0
2: 2
3: 43
4: 434
Right 910610056 1:89131565-89131587 ATGTGGAAATGCTAGATCAAAGG 0: 1
1: 0
2: 8
3: 74
4: 481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910610056 Original CRISPR ATGTGGAAATGCTAGATCAA AGG Intronic
901413670 1:9102684-9102706 AAGTGGAAATGCTACCTCCAGGG - Exonic
902102524 1:14003375-14003397 ATGTGGAAATGCAAGATGCTAGG + Intergenic
903038353 1:20509399-20509421 AGGTAGAATTGCTAGGTCAATGG + Intergenic
903219676 1:21862186-21862208 ACTTGGAATTTCTAGATCAAGGG - Intronic
903571986 1:24312721-24312743 GAGTGAAATTGCTAGATCAAAGG + Intergenic
903740961 1:25558202-25558224 AGGTGTCAATGCTACATCAATGG - Intronic
904513971 1:31038766-31038788 AAGTGGAATTACCAGATCAAAGG - Intronic
904692843 1:32307533-32307555 GTGTGGATATGCCAGATAAAGGG + Intronic
904792955 1:33037271-33037293 AAGTGGAATTGCTGGACCAAAGG - Intronic
905684302 1:39897853-39897875 ATGTGGAAATGCTTCATGCAGGG + Exonic
905720868 1:40200327-40200349 ATGCGGAATTGCTAAATTAAAGG - Intronic
906174952 1:43762997-43763019 AAGTGGAAATGCTGGGTCCAAGG - Intronic
906919229 1:50046711-50046733 AAGTGGAACTACTGGATCAATGG + Intergenic
906919890 1:50052624-50052646 ATGTGGAAAAGATGCATCAAGGG - Intronic
907519926 1:55016538-55016560 ATGTGGAATTGCTGAATCAAGGG - Intergenic
908448374 1:64224215-64224237 AAGTGGAAATGCTGTGTCAAAGG - Intronic
909367175 1:74839896-74839918 ATGTGAAATTGCTGGCTCAAAGG - Intergenic
910047481 1:82934916-82934938 AAGTGGAATTACTAGTTCAAAGG + Intergenic
910610056 1:89131565-89131587 ATGTGGAAATGCTAGATCAAAGG + Intronic
910697623 1:90037315-90037337 AGGTGGGATTGCTAGATTAAGGG - Intergenic
911032275 1:93501860-93501882 AAATGAAAATGCTAGATTAAAGG - Intronic
911199238 1:95027851-95027873 AAGCAGAAATGCTGGATCAAAGG - Intronic
911425055 1:97698986-97699008 ATGTGGAAAACCTAGATCCATGG - Intronic
911546157 1:99219563-99219585 AAGTGGGATTGCTAGATCATAGG + Intergenic
912586267 1:110769252-110769274 AAGTGGAATTGCTGGATCATAGG + Intergenic
912865592 1:113253435-113253457 ATGTGTAAATGTTATCTCAAAGG - Intergenic
913345762 1:117809636-117809658 ATGTGGAACTGATAGACCACAGG - Intergenic
913548267 1:119891760-119891782 AAGTGGAATTGCTAGATCATGGG - Intergenic
915879262 1:159648999-159649021 AAGTGAAATTGCTAGATTAAAGG - Intergenic
916441931 1:164835343-164835365 AAATGGAATTGCTAGATCAAAGG + Intronic
916779752 1:168012002-168012024 AAGTGGAAATATTAGGTCAATGG + Intronic
917745973 1:178007504-178007526 ATAATGAAATGCTAGCTCAAGGG + Intergenic
917783907 1:178431551-178431573 ATGTGAAATTGCTAGATCCAAGG - Intronic
917878520 1:179309397-179309419 AAGTGAAATTGCTAGGTCAAAGG + Intronic
918068997 1:181121300-181121322 ATCTGGAAATGCTAACACAAAGG - Intergenic
918489259 1:185063027-185063049 AAGTGGAATTACTGGATCAAAGG - Intronic
918777389 1:188651294-188651316 ATGTGGAAATGGGAGAGAAAGGG + Intergenic
918784156 1:188743296-188743318 ATATGAAAATGCTACATCACTGG + Intergenic
918942249 1:191015541-191015563 AAGTGGAAAGGCTGGGTCAATGG + Intergenic
919010911 1:191962035-191962057 AGGTGGAAATTCTAGATCCTAGG + Intergenic
919608871 1:199720310-199720332 ATCTGGAAAAGCTAGGTAAAGGG + Intergenic
919957699 1:202435788-202435810 TTGTGGAAATGAGAGAACAAAGG + Intronic
920148010 1:203879489-203879511 AAGTGGAATTGCTAAATCAAAGG + Intergenic
923621066 1:235579890-235579912 AAGTGGAATTGCTGGATCATAGG - Intronic
924197400 1:241622624-241622646 TTGTTGAAATTCTAGAACAATGG - Intronic
924307592 1:242707267-242707289 AAGTAGAAATGCTGGGTCAAAGG + Intergenic
1063694205 10:8317121-8317143 ATTTGGAAATTCTAGGTCAGGGG + Intergenic
1064013229 10:11753058-11753080 AAGTAGAATTCCTAGATCAAAGG + Intronic
1064151185 10:12866521-12866543 AGGTGGAATTGCTGGGTCAAGGG - Intergenic
1065923057 10:30410107-30410129 AAATGGAAATGTTAGATAAAAGG - Intergenic
1066170787 10:32842566-32842588 AAGTGGGATTGCTGGATCAAAGG - Intronic
1066309355 10:34180726-34180748 TTGTGGAAAATCTAAATCAATGG + Intronic
1066453464 10:35551992-35552014 AGGTGGAATTGCTGGATCATAGG - Intronic
1066678848 10:37916731-37916753 ATGTGGAAATTTTATATAAATGG + Intergenic
1067193245 10:44090304-44090326 ACCTGGAAATGGTAGAGCAAGGG + Intergenic
1068043037 10:51850954-51850976 AAGTAGGATTGCTAGATCAAAGG - Intronic
1068105671 10:52612811-52612833 ATCTGGGACTGCTTGATCAAAGG - Intergenic
1068735099 10:60405148-60405170 ATGTGGAATTGCTAGGTTATAGG - Intronic
1069364445 10:67682698-67682720 AAGTGGAATTGCTGTATCAATGG - Intronic
1071233677 10:83619138-83619160 ATGTGGACATGCTGGAAAAATGG + Intergenic
1071483801 10:86084507-86084529 GTGTTGAATTGCTAGATCATAGG - Intronic
1071538909 10:86461561-86461583 GTGTGGAACTGCTAAGTCAAAGG + Intronic
1071686772 10:87766219-87766241 GAGCGGAATTGCTAGATCAAAGG - Intronic
1071866657 10:89741819-89741841 ATGTGGATATGCTAGGCAAAGGG - Intronic
1071934453 10:90512257-90512279 GTGTGAAAATGCTGGATCATAGG - Intergenic
1072030455 10:91516254-91516276 ATGTAGAATTGCTGGATCACAGG + Intergenic
1072301126 10:94063381-94063403 ATGTGGCAATGCGATAGCAAGGG - Intronic
1072541913 10:96405029-96405051 AAGTGGAATTGCTGGGTCAAAGG + Intronic
1073222267 10:101885253-101885275 AAGTGGAATTGCTGGATCACAGG - Intronic
1074579199 10:114701386-114701408 ATGTGGAATTGCTAGGTCGGAGG - Intergenic
1074760059 10:116660662-116660684 ATGTGGAACTGCTTAAACAAAGG + Intergenic
1075200799 10:120402325-120402347 ATGGAGGAATTCTAGATCAAAGG + Intergenic
1075360249 10:121825802-121825824 AAGTGGAATTGCTGAATCAAAGG - Intronic
1075492550 10:122884991-122885013 ATGGTGAAATGCTAAAACAATGG + Intergenic
1075503507 10:123000580-123000602 AAGTGAAACTGCTGGATCAAAGG + Intronic
1076432395 10:130414151-130414173 GTGTGGAAAGGATAGATCAAAGG - Intergenic
1078076241 11:8163859-8163881 CTATGGAAATGCTAGGTCACAGG + Intronic
1078553459 11:12297071-12297093 AAGTGGAAATGCTGGAGCAAAGG + Intronic
1079157731 11:17964109-17964131 GTGTAGAGATGCTACATCAAGGG + Intronic
1080589645 11:33710652-33710674 AAGTGGAATTGCTGGATCAAAGG - Intronic
1080974199 11:37316603-37316625 ATCTGGAGATGCTAGATTATAGG - Intergenic
1081058585 11:38443558-38443580 ATATGGAATTACTAGATAAAGGG - Intergenic
1082014351 11:47473290-47473312 AGGTGGAAATGAAAGATCACTGG - Intronic
1082619244 11:55400134-55400156 ATGTTGAAATGTAATATCAAAGG - Intergenic
1083346270 11:61995213-61995235 ATGTGGGATTGCAGGATCAAAGG + Intergenic
1083695830 11:64441725-64441747 GAGTGGAAATGCTGGATCATAGG + Intergenic
1083959780 11:66008081-66008103 AGGAGGAAATGGGAGATCAAAGG - Intergenic
1084983975 11:72851244-72851266 AAGCGGAATTGCTAGATCAATGG - Intronic
1084999030 11:73011999-73012021 AGGGAGAAATGCTGGATCAAAGG - Intronic
1085948120 11:81297247-81297269 ATGTGAAAAAGCTAGATTAGTGG + Intergenic
1086026713 11:82302138-82302160 CATAGGAAATGCTAGATCAATGG + Intergenic
1086105614 11:83143991-83144013 AGGTGGAATTGCTAGTTCAAGGG - Intergenic
1086787374 11:90986173-90986195 ATGTAGAAATAATAGATCCAAGG - Intergenic
1087229376 11:95642636-95642658 ATGTGGCAATGATGGATCAGTGG + Intergenic
1087546497 11:99591077-99591099 ACGTGGAGATGTTACATCAAAGG - Intronic
1088322085 11:108564638-108564660 ATGTGGAATTGCCAGGCCAAAGG + Intronic
1088646672 11:111922793-111922815 ATATGGAATTGCTACATCAGAGG + Intronic
1089057111 11:115594591-115594613 TAGTGGAACTGCTGGATCAATGG + Intergenic
1089252866 11:117178061-117178083 AAGTGGAATTACTGGATCAAAGG + Intergenic
1089294680 11:117460539-117460561 CTGTGGAAATGCTCCATTAAAGG - Intronic
1092365878 12:7876566-7876588 AAGTGGAATTGCTGGATCATAGG - Intronic
1092508819 12:9131547-9131569 AGGTGAAAAAGTTAGATCAAAGG + Intergenic
1093520764 12:20047378-20047400 ATGTGGAAATCCTAAATCCAAGG - Intergenic
1093845255 12:23963494-23963516 ATATGGAAATGCCAGATTCAAGG - Intergenic
1094345072 12:29459105-29459127 GAGTGGGATTGCTAGATCAATGG - Intronic
1096356812 12:50948520-50948542 AAGTGGAATTGCTGGGTCAAAGG - Intergenic
1096706293 12:53424456-53424478 AGGTGGAAATGCAAGGTGAATGG + Exonic
1096762854 12:53857361-53857383 AGGTGGAAATGCTAGATTGATGG - Intergenic
1097238909 12:57560384-57560406 AAGTAGAATTTCTAGATCAATGG + Intronic
1097810349 12:64012484-64012506 ATGTGGCAATTCTTGTTCAAGGG + Intronic
1099015590 12:77339975-77339997 GTGTATAAATTCTAGATCAAGGG + Intergenic
1099068713 12:78017937-78017959 AGGTGGAAATACTAGAGAAACGG + Intronic
1099403214 12:82225714-82225736 ATGTGAAATTGCTGAATCAAAGG + Intronic
1099578624 12:84411734-84411756 ATGTGGAATTGCCTAATCAAAGG - Intergenic
1099729471 12:86481456-86481478 AAATGGAAATGCTACATCAGAGG - Intronic
1099897419 12:88666779-88666801 ATGTGGAAATGCGAGGTGACGGG + Intergenic
1100097380 12:91057912-91057934 AAGTGGAAACAATAGATCAAAGG - Exonic
1100291980 12:93224308-93224330 AAGTGGAACTGCCAAATCAATGG - Intergenic
1101049893 12:100851080-100851102 AAGTGGAAATACCAGATCAAAGG + Intronic
1101357076 12:103990152-103990174 AGGTGGAATTGCTAGATTGAAGG + Intronic
1102043028 12:109812800-109812822 ATGAGAAAATGGTAGATGAATGG + Intronic
1102132918 12:110547064-110547086 AGATGGAATTGCTAGATGAAAGG - Intronic
1102371274 12:112383844-112383866 AAGTTGAATTGCTGGATCAAAGG - Intergenic
1102487860 12:113270338-113270360 ATCTGGAAGTCCAAGATCAAAGG + Intronic
1103072778 12:117958400-117958422 AAATGGAACTGCTGGATCAAAGG - Intronic
1103289666 12:119834726-119834748 AAGTGGAATTACTAGGTCAAAGG - Intronic
1104209300 12:126671741-126671763 AGGCAGAAATGCCAGATCAAAGG + Intergenic
1104495936 12:129238846-129238868 ATGTGGAACTTCTGGATCATAGG + Intronic
1104604053 12:130175046-130175068 AAGTGGAATTGCTGGGTCAAAGG - Intergenic
1104708133 12:130963811-130963833 AGGTGGAATTACTAGATCAAAGG + Intronic
1106148055 13:27069576-27069598 AAGTAGAATTGCTGGATCAAAGG - Intronic
1106276165 13:28209678-28209700 ATGTGAGTTTGCTAGATCAAGGG + Intronic
1106855959 13:33853177-33853199 CTGTGGAAATGCCACATGAAAGG - Intronic
1106905476 13:34404831-34404853 GAGTGGAATTGCTAGATCATGGG - Intergenic
1107671594 13:42751766-42751788 ATGTGTAAATGCTGGGTCAAAGG - Intergenic
1108474768 13:50803128-50803150 AATTGGAATTGCTAGGTCAAAGG + Intronic
1109037890 13:57289039-57289061 ATGAGCATATTCTAGATCAACGG - Intergenic
1109834306 13:67836293-67836315 AAGTGGAATTGCTAGATCATAGG - Intergenic
1109883775 13:68515589-68515611 ATGATGTATTGCTAGATCAAAGG + Intergenic
1110239024 13:73246373-73246395 ATGTGGTAATGATAGAACAATGG - Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1110711047 13:78651435-78651457 ATATTGAAATGGTAGGTCAAGGG - Intronic
1111905426 13:94250394-94250416 ATGTGGAAATATTTTATCAATGG + Intronic
1112099445 13:96170878-96170900 AAGTAGGAATGCCAGATCAAGGG + Intronic
1112513571 13:100032093-100032115 AAGTGGATATGCTAAGTCAAAGG - Intergenic
1112712593 13:102147397-102147419 ATATGGAAATGCTGAATAAATGG - Intronic
1112834549 13:103498022-103498044 CTGTGGAAATGTGAGAGCAAAGG - Intergenic
1113491706 13:110697413-110697435 AAGCGGAATTGCTAGGTCAAAGG - Intronic
1114875931 14:26717717-26717739 ATGTTGAAATTCTAGTCCAAAGG - Intergenic
1115149873 14:30272069-30272091 ATGTGGAAGTGCCAGATCCTAGG - Intergenic
1115524012 14:34261327-34261349 ATGGGGGAATGCTAGATCATAGG + Intronic
1115589618 14:34851506-34851528 ATGTGGAAATCATACAACAAAGG - Intronic
1115938419 14:38581370-38581392 ATGAGGAAATGTTAAATAAATGG + Intergenic
1116828181 14:49692172-49692194 ATGTGGAATTGCTGGGTCAGAGG - Intergenic
1116857688 14:49967586-49967608 AAGTGGAATTTCTGGATCAAAGG + Intergenic
1117245293 14:53878740-53878762 ATGTGGAAATGCTGGTTAGAAGG + Intergenic
1117342939 14:54807324-54807346 AGGTGAAATTGCTAGGTCAAAGG + Intergenic
1117403363 14:55378279-55378301 ACGTGGAATTGCTTGGTCAAAGG - Intronic
1117810645 14:59542438-59542460 AAGTTGAAGTGCTGGATCAAAGG - Intronic
1117951585 14:61088141-61088163 ATGTAGAATTGCTATATCAAAGG + Intergenic
1118000722 14:61520860-61520882 AAGTAGAAATGCCATATCAAAGG - Intronic
1118743793 14:68759753-68759775 ATGAGGAAATGCAGGTTCAAAGG - Intergenic
1119368752 14:74119497-74119519 AAGTGGAATTGCTAGATCATAGG + Intronic
1119487348 14:74999229-74999251 AAGTGGAACAGCTAGATCAGAGG - Intergenic
1120168623 14:81226537-81226559 ATTTGGCATTGCTAGGTCAATGG - Intergenic
1120540565 14:85745298-85745320 AAGTGGAATTGCTGGATCACAGG - Intergenic
1120656365 14:87194853-87194875 AAGTAGAAATGCTTGGTCAAAGG - Intergenic
1120897269 14:89544786-89544808 GTGTAGAAATGCTAGACAAAGGG + Intronic
1122479253 14:102035500-102035522 AAGTGGAACTCCTAGGTCAAAGG - Intronic
1124045751 15:26148415-26148437 ATGTGTGAATGTCAGATCAACGG + Intergenic
1124391024 15:29257524-29257546 AAGTGGCATTGCTGGATCAACGG + Intronic
1125116789 15:36103167-36103189 AAGTGGAAAAGATATATCAAAGG - Intergenic
1125910214 15:43431095-43431117 ATATGGATATGCTAGAAAAAGGG + Intronic
1126444158 15:48723276-48723298 ATGTGCAACTTCTAGATCAGTGG - Intronic
1126578001 15:50216429-50216451 AAGTGGGATTGCTGGATCAATGG - Intronic
1127062194 15:55197963-55197985 ATGTAGAACTGCTGGATCAGAGG + Intergenic
1127351702 15:58159306-58159328 ATGTGGAAATGATAAATAGACGG - Intronic
1127579268 15:60322494-60322516 ACGTGGAATTGTTGGATCAAAGG + Intergenic
1128088382 15:64901793-64901815 AAGTGCAATTGCTGGATCAATGG - Intronic
1128266502 15:66271457-66271479 ATGTGCAAATTCCAGACCAAAGG - Intergenic
1128408159 15:67365245-67365267 CTGTGGAACTTCTTGATCAAAGG + Intronic
1129004916 15:72364588-72364610 AGGTGGAAATGCTAGGCCACAGG + Intronic
1129920387 15:79314670-79314692 ATGTGGCAAAGCTGGATGAAAGG + Intronic
1129932436 15:79422945-79422967 AAGTGGAACTGCTGAATCAAAGG - Intronic
1130209872 15:81913088-81913110 ATGTGGAAATGCAGGATTCAGGG - Intergenic
1130808486 15:87352397-87352419 TTGGGAAAATGCTATATCAAGGG + Intergenic
1131193531 15:90336506-90336528 AAGTGGAAATGCTAGGTCAAAGG + Intergenic
1131341053 15:91601296-91601318 AAGTGGAAATGCTACATAGAAGG - Intergenic
1131573960 15:93567660-93567682 AAGTAGAATTGCTGGATCAAAGG - Intergenic
1132425805 15:101715824-101715846 AATTGGAATTACTAGATCAAAGG + Intronic
1133122859 16:3621856-3621878 AAGTGGAATTGCTGGGTCAAAGG + Intronic
1133293497 16:4738014-4738036 TCGTGGAAATGCTAGAACAGTGG - Intronic
1134587415 16:15423967-15423989 ATGTGAAATTGCTGAATCAAAGG - Intronic
1134884950 16:17782176-17782198 GAGTGGAACTGCTAGATCATAGG - Intergenic
1135104695 16:19638714-19638736 ATGTGGAGACGCTAGACAAAGGG + Intronic
1135128936 16:19835918-19835940 AAGTGGAATTGCTGGGTCAAAGG + Intronic
1135681088 16:24457471-24457493 AAGTGGAATTGCTGGACCAAAGG + Intergenic
1136521594 16:30799966-30799988 AAGTGGAATTGCTGCATCAAAGG - Intergenic
1136652665 16:31686193-31686215 AAGTGGAATTGCTAGATCATAGG - Intergenic
1136672150 16:31868054-31868076 AAGTGGAATTGCTGGATCATAGG - Intergenic
1136712077 16:32247142-32247164 ATGTGGAGAGACTAGATTAAAGG - Intergenic
1136755836 16:32682262-32682284 ATGTGGAGAGACTAGATTAAAGG + Intergenic
1136812276 16:33188110-33188132 ATGTGGAGAGACTAGATTAAAGG - Intergenic
1136818752 16:33298190-33298212 ATGTGGAGAGACTAGATTAAAGG - Intronic
1136825316 16:33354723-33354745 ATGTGGAGAGACTAGATTAAAGG - Intergenic
1136830382 16:33453494-33453516 ATGTGGAGAGACTAGATTAAAGG - Intergenic
1137904990 16:52311987-52312009 AAGTAGAATTGCTGGATCAATGG - Intergenic
1138328811 16:56195791-56195813 TTCTGGAAATGCTAAATAAAAGG - Intronic
1139808279 16:69588827-69588849 ATGTTGAAATGCCAGATTAGAGG + Intronic
1140077333 16:71713444-71713466 AAGTGGAACTGCTGGGTCAAAGG - Intronic
1202990854 16_KI270728v1_random:11080-11102 ATGTGGAGAGACTAGATTAAAGG - Intergenic
1203057978 16_KI270728v1_random:942618-942640 ATGTGGAGAGACTAGATTAAAGG + Intergenic
1142543749 17:682981-683003 AAATGGAAATGCTAGAAAAAAGG + Intronic
1142826794 17:2517961-2517983 AAGTGGAATTGCCAGATCACAGG - Intergenic
1143976483 17:10834060-10834082 AAGTGGAACTGCTGGGTCAAAGG - Intronic
1144570530 17:16395485-16395507 ATGTGGAATTGCTGGCACAAAGG - Intergenic
1144965298 17:19073529-19073551 ATGTGGAGAAGTGAGATCAAGGG - Intergenic
1144982669 17:19178654-19178676 ATGTGGAGAAGTGAGATCAAGGG + Intergenic
1144985554 17:19199585-19199607 ATGTGGAGAAGTGAGATCAAGGG - Intergenic
1145302510 17:21650623-21650645 ATGTCGAATTGCCAAATCAAGGG - Intergenic
1145415789 17:22712748-22712770 ATGTCGAATTGCCAAATCAAGGG - Intergenic
1146026492 17:29326135-29326157 ATGTGGAAATGCTACCCCTAAGG + Intergenic
1146158000 17:30540412-30540434 AAGTGGAATTGGTAGATCATAGG + Intergenic
1146304214 17:31718112-31718134 AAGTGGAACTGCTGGATCATAGG - Intergenic
1146920904 17:36710447-36710469 AAGTGGAATTACTAGATCAAAGG + Intergenic
1148358265 17:46990997-46991019 AAGTGGAATTGCTGGAGCAAAGG - Intronic
1150788672 17:68182890-68182912 AAGTGGAATTGCTGGAGCAAAGG + Intergenic
1151408959 17:73908043-73908065 ATGTGGAACTGCTGGATCAAAGG - Intergenic
1152439789 17:80299373-80299395 AAGTGGAACTGCTAGGTCAAAGG + Intronic
1153861404 18:9212626-9212648 AAGTGAAATTGCTAAATCAATGG + Intronic
1154477670 18:14780073-14780095 ATGTGAAAATGCAAAATCAGAGG + Intronic
1155162794 18:23209199-23209221 ATGTAGATATGCTGGACCAAGGG - Intronic
1155837733 18:30608084-30608106 ATGTGGGCATGCCAGATCTATGG - Intergenic
1156339010 18:36194561-36194583 AAGTGGAATTGCTAGGTCAAAGG + Intronic
1156364133 18:36409719-36409741 ATGTGGAAAAGCTAGAGCTTTGG + Intronic
1158162787 18:54504813-54504835 ATGTTGAAGTGCTGGATCAAAGG - Intergenic
1158274081 18:55747699-55747721 TTGTGGAAATGCAAAGTCAAAGG + Intergenic
1158623699 18:59053684-59053706 AACTGGAATTGCTAGGTCAAAGG + Intergenic
1159050798 18:63419475-63419497 AAGTGGAAAGGATTGATCAAAGG - Intronic
1161372897 19:3923677-3923699 ATGGGTAAATGGTAGATGAATGG + Intronic
1165565440 19:36723284-36723306 GTCTGGAAATGCAAAATCAAAGG - Intronic
1166030968 19:40127475-40127497 AAGTGGGATTGCTAGATCTAAGG - Intergenic
1166827416 19:45617997-45618019 ATGTGGGAATGCTGGGACAAAGG + Intronic
1167135836 19:47614905-47614927 AAGTGGGATTGCTAGATCAAGGG + Intronic
1167190252 19:47983264-47983286 AGGTGGGAATCCAAGATCAATGG + Intronic
1168476336 19:56678114-56678136 AGGCTGAAATCCTAGATCAAGGG - Intergenic
925015075 2:517494-517516 ATTGAGAAATGCCAGATCAATGG - Intergenic
925631429 2:5897515-5897537 ATGTGGAAATGCACAATCTATGG + Intergenic
926327129 2:11795094-11795116 TTATGCAAATGCTTGATCAAGGG - Intronic
926653882 2:15377411-15377433 AAGTGGAATTGCTGAATCAAAGG - Intronic
927644116 2:24864911-24864933 AAGTGGAATTGCTGGATCAAAGG - Intronic
927739607 2:25556288-25556310 ATGAGGAACTGTTAGGTCAAAGG + Intronic
928433297 2:31238035-31238057 AAGTGGAATTGCTAGGCCAAAGG + Intronic
929387060 2:41421836-41421858 AAGTGGAATTCCTAGATCACAGG + Intergenic
929440212 2:41959965-41959987 AAGTGGAATTGCTTGATTAAAGG - Intergenic
929492743 2:42410324-42410346 AAGTGGTACTGCTTGATCAAGGG + Intronic
929880119 2:45829201-45829223 AAGTGGAATTGCAAGATTAAAGG + Intronic
930548947 2:52806956-52806978 ATTTGGCAATGTTAGAACAATGG + Intergenic
931103552 2:59029818-59029840 ATGTGAAAATGCTTGAGAAATGG + Intergenic
931448097 2:62344119-62344141 AAGTGGAATTGCTAGGTCAAAGG + Intergenic
931536637 2:63284892-63284914 ATGTGCAAATGCTTGTTCTAGGG - Intronic
932069538 2:68604936-68604958 ATGTGGGATTGCTAGGTCAAGGG + Intronic
932402504 2:71490972-71490994 AAGTGGGATTACTAGATCAAAGG + Intronic
933059778 2:77723261-77723283 ATATAGAAAAGCTACATCAAAGG + Intergenic
933154094 2:78951965-78951987 ATGTTGATATGCTATCTCAAAGG - Intergenic
933732519 2:85468181-85468203 ATATTGAATTGCTAGATCATAGG - Intergenic
935523013 2:104132581-104132603 ATCTGAAAATGTTACATCAATGG - Intergenic
936483788 2:112909175-112909197 ATGTGTAAATGCTAGACCAAAGG - Intergenic
937476121 2:122216953-122216975 ATGTTGAAATCCTAGTTCCAAGG + Intergenic
938717558 2:134034853-134034875 ATGTGGCAATCCTTGACCAATGG - Intergenic
939135035 2:138283555-138283577 AAGTGGGATTGCTAGATCATAGG - Intergenic
940032144 2:149274784-149274806 AATTGGAAATGCTTGTTCAAGGG + Intergenic
940351523 2:152695028-152695050 ATTTCAAAATCCTAGATCAAAGG + Intronic
940410572 2:153359208-153359230 AACTGGAATTGCCAGATCAAAGG + Intergenic
941081693 2:161069029-161069051 ATTTGGAATGGCTAGATCAAAGG - Intergenic
941652265 2:168104782-168104804 AACTGGAAATGCAAGGTCAAAGG - Intronic
942338622 2:174918958-174918980 ATATGGAAATGCTAACTGAATGG - Intronic
942512663 2:176718730-176718752 ATGTGGGAATGGGAGACCAATGG + Intergenic
942968848 2:181932012-181932034 ATGTGGAAATGAAAAATGAAAGG + Intergenic
943079236 2:183237532-183237554 ATTTGGAAATTCCTGATCAAAGG + Intergenic
943289346 2:186048686-186048708 ATGTGAATATGCTAGATAAAGGG + Intergenic
943360542 2:186913819-186913841 ATGTGGAAATATGAGATCAAGGG - Intergenic
944408042 2:199407694-199407716 AACTGGAAATGCTAGAACAATGG + Intronic
944444056 2:199772161-199772183 GTGTGGATATGCTAGACAAAGGG + Intronic
944475226 2:200096818-200096840 GTGTAGAATTGCTGGATCAAAGG + Intergenic
944728167 2:202492758-202492780 AAGTGGGAAAGCTAGAGCAAGGG + Intronic
946801440 2:223420446-223420468 AAGTGGAAATGCCAGGTCATAGG + Intergenic
947114859 2:226758703-226758725 ATGTGGAAATGAAACATAAAAGG + Intronic
947571326 2:231237487-231237509 AAGTGGAATTGCTAGGGCAAAGG + Intronic
948539658 2:238680733-238680755 AAGTGGAATTGCTGGGTCAAGGG + Intergenic
948671722 2:239572883-239572905 AAGTGGAATTGCTGGATCATAGG + Intergenic
1169070668 20:2727593-2727615 AAGTGGAATTGCTGAATCAATGG + Intronic
1171004281 20:21448831-21448853 AAGTGGAATTGCTGGCTCAAAGG + Intergenic
1171519103 20:25762135-25762157 ATGTCGAATTGCCAAATCAAGGG - Intergenic
1171557822 20:26094353-26094375 ATGTCGAATTGCCAAATCAAGGG + Intergenic
1171724100 20:28599657-28599679 ATGTGGAATTGCTGTGTCAAAGG - Intergenic
1171753956 20:29083376-29083398 ATGTGGAATTGCTGTGTCAAAGG + Intergenic
1171788287 20:29494152-29494174 ATGTGGAATTGCTGTGTCAAAGG - Intergenic
1171859265 20:30380368-30380390 ATGTGGAATTGCTGTGTCAAAGG + Intronic
1172076743 20:32304424-32304446 AAGTGGAATTGCTGAATCAAAGG - Intronic
1172360646 20:34310539-34310561 AAGTGGAACTGCTTGGTCAAAGG - Intronic
1172529769 20:35621911-35621933 AAGTGGAAGTGCTAGATCAAAGG - Intergenic
1172529985 20:35624004-35624026 AAGTGGAAATGCTATATCAAAGG - Intergenic
1172980074 20:38934586-38934608 AAGTGGAAGTGGTAGATCAATGG - Intronic
1173044415 20:39495864-39495886 GAGTGGAATTGCTGGATCAATGG - Intergenic
1173442689 20:43092320-43092342 ATCTGGAAATGCCAGACCCATGG - Intronic
1174394240 20:50236743-50236765 AAGTGGAATTGCTGCATCAACGG + Intergenic
1174948511 20:55015625-55015647 ATATGGAAATGCTGGTCCAAGGG + Intergenic
1175292558 20:57886592-57886614 TAGTGGGATTGCTAGATCAAAGG + Intergenic
1176653240 21:9568425-9568447 ATGTCGAATTGCCAGATCAAGGG - Intergenic
1177033628 21:16014512-16014534 ATGTGGATATGCTAGACAAAAGG - Intergenic
1177462895 21:21436271-21436293 AGGTGGAAATGCTACTTTAAAGG - Intronic
1177755560 21:25342922-25342944 GTGTGGAAATGATTCATCAAGGG + Intergenic
1177773361 21:25541702-25541724 ATGTGGAATTGCTGTGTCAAAGG - Intergenic
1177939263 21:27388936-27388958 ATGTGGAAATGTTTGCTTAAAGG + Intergenic
1178962397 21:37077428-37077450 AAATGGGATTGCTAGATCAAGGG + Intronic
1179005449 21:37509963-37509985 GTGTGGACATGCTAGACGAAGGG - Intronic
1179832231 21:44004390-44004412 AAGTGGAATTGCTGGCTCAAAGG + Intergenic
1180297652 22:10958333-10958355 ATGTGGAATTGCTGTGTCAAAGG - Intergenic
1180410772 22:12605453-12605475 ATGTGGAATTGCTGTGTCAAAGG + Intergenic
1180788532 22:18560406-18560428 AGGTGGAAATTCTACATGAAAGG + Intergenic
1181233205 22:21434912-21434934 AGGTGGAAATTCTACATGAAAGG - Intronic
1181245445 22:21499931-21499953 AGGTGGAAATTCTACATGAAAGG + Intergenic
1183189004 22:36309510-36309532 GGGTGGAAATGCTGGATCAAAGG - Intronic
1184526737 22:45028424-45028446 AGGTGGAAGTCCAAGATCAAGGG - Intergenic
1184580837 22:45416356-45416378 AAGTGGAATTGATGGATCAAAGG + Intronic
1185144692 22:49125099-49125121 AGGTGGAAATGCTGGATTATAGG + Intergenic
949502612 3:4695916-4695938 AAGTGGAAGTGCTGGATCACAGG + Intronic
950246595 3:11425341-11425363 AAGTGGAATTGCTAGATTAAAGG + Intronic
950708007 3:14795203-14795225 AAGTGGAAGTGCTGGACCAAAGG - Intergenic
951256550 3:20456768-20456790 ATGAGGAAATACGAAATCAAGGG + Intergenic
951321995 3:21255868-21255890 AAGTGGAATTGCTATGTCAAAGG + Intergenic
951935701 3:28020568-28020590 AAGTGGAATTGCTGGGTCAAAGG - Intergenic
952877577 3:37959738-37959760 TTGTGGAAATGCTAGGTCAAAGG + Intronic
953017307 3:39090007-39090029 AAGTGGAATTGCTGGATCCAAGG + Intronic
953437096 3:42886513-42886535 GTGTGGATATGCTAGACAAAGGG + Intronic
953515687 3:43589698-43589720 AAGTGAAATTGTTAGATCAAAGG - Intronic
953819517 3:46193195-46193217 GACTGGAAATGCTAGATCACAGG - Intronic
954167984 3:48776299-48776321 AAATGGAATTGCTATATCAAAGG - Intronic
954268414 3:49488391-49488413 ATGTGGAATTGCTGGGTCAAAGG - Intronic
955581990 3:60433434-60433456 AAGTGGTATTGCTAGATCATGGG + Intronic
956424839 3:69123333-69123355 AAGTGGAATTGCTGGGTCAAAGG - Intergenic
957351885 3:79034490-79034512 AGTTGGAAATACTATATCAAAGG - Intronic
957419045 3:79944860-79944882 GAGTGGGATTGCTAGATCAAAGG - Intergenic
957847850 3:85762020-85762042 TTGTGGAAATACTAAATGAAAGG + Intronic
958716350 3:97787028-97787050 ATGTGGAATTGTTGGGTCAAAGG - Intronic
961118047 3:124348662-124348684 AAGTGGAATTGCTGGATCTATGG - Intronic
961466748 3:127086427-127086449 ATGTGGAATTTCTAGATTCAAGG - Intergenic
962062056 3:131939108-131939130 AAGTAGAATTGCTGGATCAAAGG - Intronic
962387602 3:134944788-134944810 AAGTGGAATTGCTGGGTCAAAGG + Intronic
963039805 3:141060641-141060663 AAGTAGAATTGCTAGGTCAAAGG + Intronic
963347327 3:144110701-144110723 ATGTAGAAATGCTGCATCAAAGG - Intergenic
964626523 3:158765062-158765084 AAGTGGAGTTGCTGGATCAAAGG - Intronic
965206660 3:165727846-165727868 AAGGGGAATTACTAGATCAAAGG - Intergenic
965821687 3:172690543-172690565 AAGTAGAACTACTAGATCAAAGG - Intronic
966455153 3:180106568-180106590 AAGTGGAATTGTTGGATCAAAGG - Intergenic
967517395 3:190386519-190386541 ATGTGGAAATGCTGGCCAAAGGG + Intronic
968658783 4:1790145-1790167 CTGTGGAAACGCTTGAGCAAGGG + Intergenic
969080383 4:4613245-4613267 AAGTGGGATTGCTGGATCAAAGG - Intergenic
969950913 4:10834471-10834493 ATGTGGATATCCTGTATCAATGG + Intergenic
970338513 4:15079891-15079913 ATGAGGAAATGCTTAATAAATGG - Intergenic
971675523 4:29622529-29622551 ATGTAGAATTGCTAGATAAAAGG - Intergenic
972604138 4:40598737-40598759 ATGTAGAAACCCTAAATCAAAGG - Intronic
972931284 4:44073785-44073807 ATTTGGAAATGCAAAGTCAAGGG - Intergenic
975396862 4:73885436-73885458 ACTTGTAAATGCTAGATCTAGGG - Intergenic
975653828 4:76621100-76621122 AGGTGGAAATGAAAAATCAATGG - Intronic
976307697 4:83577664-83577686 AAGTGGAATTGCTAGGTCATAGG + Intronic
976456010 4:85247467-85247489 ATAATGAAATGCTAGCTCAAGGG - Intergenic
976544092 4:86313830-86313852 GGGTGGAAGTGCTAGATCATTGG - Intronic
977280359 4:95032141-95032163 ACTGGGAAATGCAAGATCAAGGG + Intronic
978168517 4:105638950-105638972 AAGTGAAATTGCTAGATCAAAGG + Intronic
978367891 4:108001710-108001732 GTGTGGATATGCTGGACCAAGGG + Intronic
979200736 4:117975007-117975029 ATGTGGATATGCTGGACAAAAGG + Intergenic
979430733 4:120626633-120626655 ATGGGGAAATACTAGTTAAAGGG + Intergenic
981509082 4:145535308-145535330 ATGTGGAAATGCTGGGTGAATGG - Intronic
982030263 4:151293571-151293593 ATGTGGAAATGCTAGTTAGGAGG - Intronic
983237636 4:165197662-165197684 AAGTGGAATTGCTATATCACAGG + Intronic
983528540 4:168785531-168785553 ATGGGGAAACTCTGGATCAAAGG - Intronic
984301551 4:177926010-177926032 ATGTGGAACTTTTAGATCATGGG + Intronic
984551128 4:181160169-181160191 ATATGGATAGGCTAGATAAAAGG - Intergenic
984731485 4:183072262-183072284 TTGTGGAATTGCTAAATCAAAGG - Intergenic
985437406 4:189943972-189943994 ATGTGGAATTGCTGTGTCAAAGG + Intronic
985483697 5:136829-136851 AAGTGGAACTGCTGGATCATAGG - Intergenic
986865302 5:11979743-11979765 ATGTGGGACTGCTGGATCAAAGG + Intergenic
987277210 5:16374608-16374630 ATGGGGATTTGCTAGATCAGTGG + Intergenic
987432261 5:17849325-17849347 AAGTGGAATTGTTAGTTCAAAGG + Intergenic
988512447 5:31876932-31876954 ATGTGAAAATGCTAGAACCTGGG - Intronic
988705224 5:33719456-33719478 AAATGGAATTGCTAGGTCAAAGG - Intronic
989317313 5:40097191-40097213 AAGTGTAATTGCTACATCAAAGG + Intergenic
990058929 5:51622297-51622319 GTGTGGAAAAGCTAGATAAAGGG - Intergenic
990858080 5:60293955-60293977 GAGTGGAATTGCTAGGTCAAAGG + Intronic
993643038 5:90429105-90429127 AAGTATAAATGCTAGTTCAAAGG - Intergenic
993813777 5:92515341-92515363 ATATGGAAATGATAGCTAAAGGG + Intergenic
994237263 5:97377318-97377340 ATGTGCAGATGGTAGATCATGGG + Intergenic
994334107 5:98543848-98543870 AAGTGGAATTGCTGGATCATGGG - Intergenic
994521419 5:100841868-100841890 GTTTTGGAATGCTAGATCAAGGG - Intronic
995456538 5:112358677-112358699 AAGTGGAATTGCTATATCATAGG - Intronic
996116588 5:119626991-119627013 ATGTGGGGACACTAGATCAAAGG - Intronic
996782656 5:127204957-127204979 AAGTGGGATTGCTGGATCAAAGG - Intergenic
996801995 5:127414657-127414679 ATGTGGGAAAGCTAGATCCCTGG + Intronic
996900962 5:128540555-128540577 AAGTGGAATTGCTGGATCAAAGG - Exonic
998241392 5:140448400-140448422 AAGTGGAATTGCTGGGTCAAAGG + Intronic
998554808 5:143112978-143113000 AAGTGAAATTGCTGGATCAATGG + Intronic
998726906 5:145028085-145028107 ATGTGAAACTGTTAGATCATAGG + Intergenic
998762890 5:145451969-145451991 ATTTGGAAAAGCAAGAACAAGGG - Intergenic
999226155 5:150026662-150026684 ATCTGGAAATTCTGGAACAAAGG - Intronic
999714629 5:154350452-154350474 AGATGGAATTGCTAGATCAAAGG - Intronic
1000247489 5:159460817-159460839 GTGTGGATATGCTGGACCAAGGG - Intergenic
1000905722 5:166963491-166963513 ATGTAAAGATGCTAAATCAATGG - Intergenic
1000943827 5:167396081-167396103 AAGTGAAAATGCTAGATCATAGG - Intronic
1000997309 5:167972584-167972606 AAGTGAAATTACTAGATCAAAGG + Intronic
1001974129 5:175982847-175982869 AAGTGAAATTGCTAGATCAATGG - Intronic
1002243305 5:177860932-177860954 AAGTGAAATTGCTAGATCAATGG + Intergenic
1002773121 6:306237-306259 AAGTAGAATTGCTAGATGAAAGG + Intronic
1002858485 6:1058734-1058756 AAGTGGAAATGCTGGGTCATAGG - Intergenic
1002914295 6:1516666-1516688 TTGGGGAAATGCCAGGTCAATGG - Intergenic
1002916374 6:1531191-1531213 AAGTGGGATTGCTAGGTCAAAGG + Intergenic
1003507296 6:6750556-6750578 ATGCAGAAATAATAGATCAAAGG + Intergenic
1003904401 6:10685903-10685925 ATGTGGAAGGGCTGGATTAAAGG - Intronic
1003972072 6:11309395-11309417 ATGTGGAATTGCTGGATGATAGG + Intronic
1004465984 6:15885275-15885297 TAGTGGAACTGTTAGATCAAAGG + Intergenic
1004597207 6:17111342-17111364 ATGTGGATATGCTGGGTCTAAGG - Intronic
1005362409 6:25043198-25043220 ATGGGGAAGTGGTACATCAAGGG + Intergenic
1005937124 6:30531844-30531866 AAGTGGAAATGCTAAATCAAAGG - Intergenic
1006528614 6:34630170-34630192 ACGTGGATATGCTAGACAAAGGG + Intronic
1006652275 6:35561461-35561483 AAGTAGAATTGCTGGATCAAAGG - Intergenic
1006968550 6:38015457-38015479 TTCTGGAAATGCTTGTTCAAAGG + Intronic
1008091649 6:47299940-47299962 AAGTGGAATTGCTGGGTCAAAGG - Intronic
1008157276 6:48031695-48031717 TTGGGGAAATGCTTCATCAATGG - Intronic
1009194167 6:60664726-60664748 AAGTGGAAAGGCCAGCTCAATGG + Intergenic
1009562072 6:65258949-65258971 ATGTGGAAATGCAAGCTGGAGGG + Intronic
1009958506 6:70488053-70488075 AAGTGGGGATGCTAGGTCAAAGG - Intronic
1010698023 6:79002536-79002558 ATGTGGATATGCTGGACAAAGGG - Intronic
1011104452 6:83763908-83763930 AAGTAGAAATGCTGGATCAAAGG + Intergenic
1011116234 6:83895958-83895980 ATTTGGAAATGCAAGATAAGAGG - Intronic
1011491222 6:87895421-87895443 AAGTGGAATTGCTGGATCATAGG - Intergenic
1011709641 6:90039282-90039304 ATGTGAAATTACTGGATCAAAGG + Intronic
1012304378 6:97633422-97633444 AAGTGGAACTGCTGGATCAAAGG + Intergenic
1012370162 6:98495139-98495161 ATGTGGATATACTGGATAAAGGG - Intergenic
1012402301 6:98851789-98851811 AAGTGGAATTGCTGGATCATAGG - Intergenic
1012409874 6:98945135-98945157 ATATGGAATTGCTAGGTCAGAGG - Intronic
1013253132 6:108354666-108354688 GTGTGGATATGCTAGACAAAGGG + Intronic
1013438889 6:110140936-110140958 GTGTGGATATGCTAGACAAAAGG + Intronic
1013867542 6:114716920-114716942 AGGTATAATTGCTAGATCAAAGG - Intergenic
1014392159 6:120875942-120875964 ATCTGGATATGCTACAGCAAAGG + Intergenic
1015785477 6:136918556-136918578 AAGTGGAATTGCTGGGTCAAAGG - Intergenic
1015876055 6:137823996-137824018 ATGTAGAAATTCAAGATCAGAGG + Intergenic
1016318458 6:142816232-142816254 AGGTGGAAATGCCTGAGCAAGGG + Intronic
1016524094 6:144980537-144980559 AAGTGGAATTGCTGGATCATAGG + Intergenic
1017229656 6:152059687-152059709 AAGTAGAATTGCTAGATAAAAGG - Intronic
1018037726 6:159895850-159895872 AAGTGGAATTGCTAGACCAAAGG - Intergenic
1018187877 6:161283403-161283425 ATGTGGAAGTGCCAGGTCACAGG - Intergenic
1018730841 6:166649304-166649326 ATGAGGAAATGCATGAACAAAGG - Intronic
1019393776 7:805464-805486 AAGTGGAACTGCTGGGTCAAGGG - Intergenic
1020341542 7:7116528-7116550 GTGTGTAATTGCTAGATAAAAGG + Intergenic
1020421507 7:8011663-8011685 AAGTAGAACTGCTAGATCATAGG + Intronic
1020530139 7:9322999-9323021 ATGTGGAGATGATAGACAAAGGG - Intergenic
1020641197 7:10755868-10755890 ATATGGAAGTGCTACATGAAAGG - Intergenic
1020643966 7:10791082-10791104 GTGTGGATATGCTGGACCAAGGG + Intergenic
1021007292 7:15414333-15414355 ATGTGAGAATGCTAGCTAAAAGG + Intronic
1021830848 7:24607405-24607427 AAGTAGAATTCCTAGATCAAAGG - Intronic
1022025856 7:26447131-26447153 ACTTGGAACTGCTGGATCAAAGG - Intergenic
1022041175 7:26582927-26582949 ATGTGAAAATACTTCATCAATGG + Intergenic
1022901336 7:34813483-34813505 ATGTGGAAGTGGTAGAGCCATGG + Intronic
1022903005 7:34828745-34828767 TTGTGGAATTACTAGATCAAAGG + Intronic
1023321524 7:39003343-39003365 AAGTAGAATTACTAGATCAAAGG - Intronic
1025279581 7:57617093-57617115 ATGTCGAATTGCCAGATCAAGGG - Intergenic
1025305150 7:57848407-57848429 ATGTCGAATTGCCAGATCAAGGG + Intergenic
1025614687 7:63107477-63107499 AGGTGGAATTGCTAGGTCAAAGG - Intergenic
1027544034 7:79503903-79503925 AAGTGGAATTGCTTGCTCAAAGG + Intergenic
1028003860 7:85537175-85537197 ATGAGGAAATCTTAGATAAATGG + Intergenic
1028075991 7:86515968-86515990 ATGTGGAAATGTTACAACAGGGG - Intergenic
1028534581 7:91878501-91878523 AAGTGGAAATGCTGAATTAAAGG - Intronic
1029199938 7:98832604-98832626 ATGTTGAAATGCTCTATAAAAGG + Intergenic
1030566611 7:111165440-111165462 AAGTGGAATTGCTGGATCACAGG + Intronic
1030730902 7:112987496-112987518 ATGTGGAAATTGCAGTTCAAAGG + Intergenic
1030866291 7:114705070-114705092 AAGTGAAAATGCTAGATAAACGG - Intergenic
1031067770 7:117124798-117124820 ATGTGGAAATGTCAGGTCAGAGG + Intronic
1031272724 7:119673284-119673306 ATATAGAAATGCTAGCCCAAGGG - Intergenic
1031381886 7:121096540-121096562 ATGTGTAATTGCCAGGTCAATGG - Intronic
1031863989 7:127017370-127017392 ATGTGGGATGGCAAGATCAAGGG - Intronic
1031915125 7:127555910-127555932 ATGAGGAACTGCTCTATCAAAGG + Intergenic
1032788905 7:135227391-135227413 AATTGAAAATGCTAAATCAAAGG - Intergenic
1033083746 7:138322812-138322834 AAGTGGGATTGCTAGATCATAGG - Intergenic
1033183463 7:139203308-139203330 ATTTGGAAACGATGGATCAAAGG - Intergenic
1034388548 7:150763190-150763212 AAGTGGAATTGCTGGATCACAGG - Intergenic
1034471996 7:151259964-151259986 GTGTGGAAGTGCTTGGTCAATGG - Intronic
1037871454 8:22501242-22501264 AAATGAAATTGCTAGATCAAGGG - Intronic
1039876134 8:41587785-41587807 AAGTGGAATTGCTGGATCTAAGG + Intronic
1042718797 8:71804876-71804898 ATGTGTAACTGCAAGAGCAAAGG - Intergenic
1043702553 8:83308774-83308796 AAATGGCAATGCTAGGTCAATGG + Intergenic
1043780648 8:84330387-84330409 CTAAGGAAATGGTAGATCAAGGG + Intronic
1044043127 8:87395472-87395494 ATGTGAAAATGCTACAATAAAGG + Intronic
1044830952 8:96248196-96248218 AAGTGGAAATGCTAGGTCAAAGG - Intronic
1045632715 8:104145220-104145242 AAGTTGAAATGCTAGGTTAAAGG + Intronic
1046044731 8:108950409-108950431 ATGTTGAAATTCTTGAGCAATGG - Intergenic
1046717144 8:117580249-117580271 ATGTGGAATTACTAGGTAAATGG - Intergenic
1047191710 8:122684308-122684330 AAGTGGAATTGCTAGACTAATGG + Intergenic
1049416088 8:142495987-142496009 ATGTGTAAATGGTAGATAGATGG + Intronic
1050235198 9:3570432-3570454 AAGTGGAATTGCTGGATCATAGG - Intergenic
1050285262 9:4095232-4095254 AAGTAGAAAGGCTAGTTCAAAGG - Intronic
1051010887 9:12412618-12412640 AAGTGGAATTGCTAGATCATAGG - Intergenic
1051325535 9:15963459-15963481 CAGTGGAATTGCTAGGTCAAAGG + Intronic
1053027100 9:34739377-34739399 AAGGGGAACTGCTGGATCAAAGG - Intergenic
1053619938 9:39804587-39804609 AAGTGGAAATGCTGGATCATAGG + Intergenic
1053725504 9:40995411-40995433 ATGTGGAATTGCTGTGTCAAAGG + Intergenic
1053878115 9:42563889-42563911 AAGTGGAAATGCTGGATCATAGG + Intergenic
1053894544 9:42730477-42730499 AAGTGGAAATGCTGGATCATAGG - Intergenic
1054233579 9:62537805-62537827 AAGTGGAAATGCTGGATCATAGG - Intergenic
1054264219 9:62902857-62902879 AAGTGGAAATGCTGGATCATAGG - Intergenic
1054340439 9:63856467-63856489 ATGTGGAATTGCTGTGTCAAAGG - Intergenic
1054737121 9:68765897-68765919 CAGTGGAACTGCTAGATCAGAGG - Intronic
1054900269 9:70361458-70361480 AAGTGGATTTGCTAGATCAAAGG - Intergenic
1056403233 9:86248581-86248603 ATGTGTAAGTGCTAGATGCAAGG - Intronic
1057461070 9:95262594-95262616 AAGTGGGATTGCTGGATCAATGG - Intronic
1057754704 9:97822949-97822971 AAGTGGAATTGCTAGGTCATAGG - Intergenic
1058380221 9:104369791-104369813 ATGAGGAAATGGTAAATTAATGG + Intergenic
1059406963 9:114107212-114107234 AAGTGGAATTGCTAGATCATGGG - Intergenic
1060054532 9:120402437-120402459 AAGTGGAATTACTAGTTCAAAGG - Intronic
1060131588 9:121105258-121105280 ATGTGGAAATGAAAGATAGATGG + Intronic
1060354190 9:122888839-122888861 AAGTGGGATTGCTAGACCAAAGG + Intronic
1060486105 9:124047335-124047357 AAGTGGAAATGCTGGGTTAAAGG + Intergenic
1060754332 9:126201623-126201645 CAGTGAAATTGCTAGATCAAAGG - Intergenic
1060800699 9:126543806-126543828 AGGTGGAAATGCTGGGTCAGAGG - Intergenic
1061567285 9:131450056-131450078 ATGAGGAACAACTAGATCAATGG - Intronic
1203449309 Un_GL000219v1:96561-96583 ATGTGGAATTGCTGTGTCAAAGG - Intergenic
1203630960 Un_KI270750v1:71875-71897 ATGTCGAATTGCCAGATCAAGGG - Intergenic
1186707769 X:12160388-12160410 ATGTGGATATGTTAGAACCATGG + Intronic
1186787554 X:12967900-12967922 ATGTGGTAATGCTCGATCACTGG - Intergenic
1186833580 X:13415659-13415681 ATGTAAAAATGCTAGCTCTAAGG - Intergenic
1186879719 X:13853008-13853030 AAGTGGGAATCCTGGATCAAAGG + Intronic
1187010344 X:15271986-15272008 GAGTGGAAATGCTAAGTCAAAGG + Intergenic
1187226896 X:17381803-17381825 AAGAGGAATTGCTGGATCAAAGG + Intronic
1187441563 X:19325472-19325494 AAGTGGAATTGCTAGGTCAATGG - Intergenic
1187799628 X:23046491-23046513 ATGTACAAATGCTAGATGAGAGG - Intergenic
1188013043 X:25077704-25077726 AAGTGGAATTTCTAGATCACAGG - Intergenic
1189291903 X:39892332-39892354 AAATGGAATTGCTGGATCAAAGG + Intergenic
1189810612 X:44777644-44777666 GAGTGGAATTGCTAGATCACAGG + Intergenic
1189963038 X:46343206-46343228 ATGTGGGATTGCTAGGTCAAGGG + Intergenic
1190405426 X:50081951-50081973 AAGTGGAATTGCTGGGTCAAAGG - Intronic
1190617353 X:52248945-52248967 ATGTGGAACTACTAGATCATAGG - Intergenic
1190861401 X:54348161-54348183 AACTAGAATTGCTAGATCAAAGG + Intronic
1191199024 X:57758451-57758473 AGGTGGGATTGCTAGATCACAGG - Intergenic
1191754365 X:64578191-64578213 AAGTGGAATTGCTGGGTCAAGGG + Intergenic
1192586280 X:72320514-72320536 AAGTGAAACTGCTGGATCAAAGG - Intergenic
1192944629 X:75951941-75951963 TAGTGGAATTGCTAGATCAAAGG + Intergenic
1193218244 X:78890747-78890769 AAGTGGAATTGCTGGATCATAGG - Intergenic
1193669137 X:84362351-84362373 ATCAGGAAAAGCTAGGTCAAAGG + Intronic
1193682024 X:84533369-84533391 AGGTGGAAATGAAAGGTCAAGGG - Intergenic
1195738746 X:108040529-108040551 AAATGGAATTGCTTGATCAAAGG - Intergenic
1195885375 X:109632002-109632024 GTGTGGAAATGCTGGGTCATGGG + Intronic
1195912947 X:109906965-109906987 TAGTGGAATTGCTGGATCAAAGG + Intergenic
1197308560 X:124875094-124875116 ATGTTAAAATGATAGATTAAGGG + Intronic
1197686953 X:129450521-129450543 AAATGGAATTGCTAGGTCAAAGG - Intronic
1199398855 X:147373322-147373344 AATTGGAAATTCTAGAGCAATGG - Intergenic
1199491087 X:148401520-148401542 ATGTGAAAATGATAAATCAGTGG + Intergenic
1199846713 X:151696909-151696931 TTGTGGAAACGCCACATCAAGGG - Intronic
1200183804 X:154168666-154168688 ATATGGAATTGCTAGATAACAGG - Intergenic
1200189458 X:154205794-154205816 ATATGGAATTGCTAGATAACAGG - Intergenic
1200195211 X:154243603-154243625 ATATGGAATTGCTAGATAACAGG - Intergenic
1200200863 X:154280724-154280746 ATATGGAATTGCTAGATAACAGG - Intronic
1201674138 Y:16560017-16560039 CTGTGGATATGCTACATGAAAGG - Intergenic
1202337803 Y:23829019-23829041 ATTTGGAAAGGCTAGAGCAGGGG - Intergenic
1202532963 Y:25841052-25841074 ATTTGGAAAGGCTAGAGCAGGGG + Intergenic