ID: 910613254

View in Genome Browser
Species Human (GRCh38)
Location 1:89167610-89167632
Sequence CTGGAGTCCCTCATTAATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 94}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910613254_910613258 21 Left 910613254 1:89167610-89167632 CCATCATTAATGAGGGACTCCAG 0: 1
1: 0
2: 1
3: 14
4: 94
Right 910613258 1:89167654-89167676 GTGTGAAGGTAAACTGGCCATGG 0: 1
1: 0
2: 0
3: 14
4: 134
910613254_910613259 25 Left 910613254 1:89167610-89167632 CCATCATTAATGAGGGACTCCAG 0: 1
1: 0
2: 1
3: 14
4: 94
Right 910613259 1:89167658-89167680 GAAGGTAAACTGGCCATGGATGG 0: 1
1: 0
2: 1
3: 11
4: 180
910613254_910613256 7 Left 910613254 1:89167610-89167632 CCATCATTAATGAGGGACTCCAG 0: 1
1: 0
2: 1
3: 14
4: 94
Right 910613256 1:89167640-89167662 AGATAAAGTATTTTGTGTGAAGG No data
910613254_910613257 15 Left 910613254 1:89167610-89167632 CCATCATTAATGAGGGACTCCAG 0: 1
1: 0
2: 1
3: 14
4: 94
Right 910613257 1:89167648-89167670 TATTTTGTGTGAAGGTAAACTGG 0: 1
1: 0
2: 2
3: 15
4: 222
910613254_910613260 26 Left 910613254 1:89167610-89167632 CCATCATTAATGAGGGACTCCAG 0: 1
1: 0
2: 1
3: 14
4: 94
Right 910613260 1:89167659-89167681 AAGGTAAACTGGCCATGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910613254 Original CRISPR CTGGAGTCCCTCATTAATGA TGG (reversed) Intronic
900924362 1:5693987-5694009 CAGGAATCCCTCATTGCTGAGGG - Intergenic
901158123 1:7154326-7154348 CTGGAGTCATTGATAAATGAGGG + Intronic
901781617 1:11598228-11598250 CTGGAGTCCCACAGTGTTGAAGG + Intergenic
906122274 1:43402175-43402197 CCTGTGTCCCTGATTAATGAGGG - Intronic
908177444 1:61569701-61569723 CTGGAGTCCCTCAAAACTCAAGG - Intergenic
910613254 1:89167610-89167632 CTGGAGTCCCTCATTAATGATGG - Intronic
910852029 1:91657768-91657790 CTGGAATCACTCACTTATGAGGG + Intergenic
913484214 1:119318991-119319013 CTTGAGTCCCTAAGTAATGATGG + Intergenic
915444141 1:155965302-155965324 GTGGAATCCCTCATTGACGAAGG - Exonic
917178238 1:172262536-172262558 CTGGAGTGGCTCCTTAATGTGGG - Intronic
918162862 1:181917553-181917575 AAGGAGTCCATGATTAATGATGG - Intergenic
920055143 1:203185816-203185838 CCAGAGTCCCTCATGGATGAAGG - Intronic
920244172 1:204575627-204575649 CTGAAGTCCCTGAAGAATGAGGG + Intergenic
922366246 1:224866758-224866780 CTGGGTTCCCTCATTAATAATGG - Intergenic
923997715 1:239514622-239514644 CTGGAAACCCTCATTAATGCAGG - Intronic
924386536 1:243503594-243503616 CTGAAGATCATCATTAATGAAGG + Exonic
1062931526 10:1356026-1356048 CTCTAGTGCCTCATTAAGGAAGG + Intronic
1063382971 10:5597638-5597660 CTGGGGTCCCTCAGTACTAAAGG - Intergenic
1066457501 10:35585053-35585075 ATGGGGTCCCTCATTAAGAAGGG - Intergenic
1075020513 10:118948748-118948770 CTGGAGTCCTTCCTCAAGGAAGG - Intergenic
1076576848 10:131475134-131475156 CTGGAGTGCCTCATGGATGTGGG - Intergenic
1077642626 11:3895217-3895239 CAGGAGTCCCTAAGTAATTAAGG - Intronic
1078428634 11:11270566-11270588 CTGTGGTCCCTCAGGAATGAAGG + Intergenic
1080037209 11:27722200-27722222 CTGGAGACCCTTAGTCATGATGG - Intergenic
1082686957 11:56250681-56250703 CTGTAGTCCCTCATTTATGAGGG + Intergenic
1083736455 11:64684385-64684407 GTGGAGTCACTCCTTAATGCGGG - Intronic
1085862945 11:80256158-80256180 CTGGAGTGCATCAGTAATTAGGG + Intergenic
1095943027 12:47738726-47738748 GTGGTTTCCCTCATGAATGAAGG + Exonic
1096140236 12:49236904-49236926 ATGGTGGACCTCATTAATGATGG - Intronic
1099459871 12:82909316-82909338 CTGGAGTCCTGCATTCATGAAGG + Intronic
1104267303 12:127245425-127245447 CTGGACTATCTCATTAAAGAAGG + Intergenic
1107820864 13:44284533-44284555 CTGGAGTCACTTACTCATGAAGG - Intergenic
1112725939 13:102304528-102304550 CTGGAGTCCCTCTTGAAGGCTGG - Intronic
1113612731 13:111659047-111659069 CTGGCGCCCCTCAGTAATGAAGG - Intronic
1114702078 14:24688867-24688889 CAGGAGGCCCTCAATAAGGAGGG + Intergenic
1125042390 15:35205754-35205776 GTGGTGTCAGTCATTAATGAAGG + Intergenic
1125381794 15:39093513-39093535 ATGGGGTCCCTCAATAATAAGGG + Intergenic
1127431390 15:58912818-58912840 CTTGAGCCCCTCATTTATTAGGG + Intronic
1127483333 15:59397145-59397167 ATGGAGTCCCTCTTTAGGGAGGG + Intronic
1130209181 15:81907642-81907664 CTGGAATCCTTTATTAATGGGGG - Intergenic
1130785667 15:87093211-87093233 CTGGTCTCCCTCTTTAATTATGG + Intergenic
1131436837 15:92429770-92429792 CTTGAGTCCCTCATTTAAGACGG - Intronic
1131508111 15:93033756-93033778 CTGGAGGACCACAGTAATGAGGG - Intergenic
1131862725 15:96671457-96671479 CTGGATGTCCTCATTTATGAAGG - Intergenic
1136341733 16:29648479-29648501 CCGAAGTCCCTAATAAATGAAGG - Intergenic
1142906321 17:3044655-3044677 CTGGACTCCCTCTTAAATGAGGG - Intergenic
1142941107 17:3380372-3380394 CTGCAGTCGCTCAGTAATCAGGG - Intergenic
1143506809 17:7370747-7370769 CAGGAGTCCCAGATTAATGCAGG - Intergenic
1150212649 17:63449858-63449880 CTGAAGTCCCTACTGAATGAGGG - Intergenic
1156192774 18:34738788-34738810 CTGGAGCTGCACATTAATGAAGG + Intronic
1156638844 18:39065408-39065430 CATGAGTTCCTCATTAGTGAAGG + Intergenic
1157000982 18:43524520-43524542 CAGTAGTCCCTCCTTAATCATGG - Intergenic
1157427676 18:47598009-47598031 CTGGATTCCCTCATGAAGGGTGG - Intergenic
1158870967 18:61687779-61687801 ATACAGTCCCTCAGTAATGAGGG - Intergenic
1160296282 18:77640282-77640304 CTGGATTCCCTGATTTTTGAAGG - Intergenic
1164468087 19:28505173-28505195 CTGGAGCCCCCCATTGCTGAGGG - Intergenic
1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG + Exonic
925478137 2:4242060-4242082 ATGGTACCCCTCATTAATGATGG - Intergenic
925975623 2:9140071-9140093 GAGGAGTCCCTGATTAATTAAGG - Intergenic
931514191 2:63033099-63033121 CTGGAGTCCTGCAATAATGTTGG + Intronic
933122367 2:78555682-78555704 ATGGACTCCCTAAGTAATGATGG + Intergenic
940142152 2:150503875-150503897 CTGGATTCCCTGATTAATGTGGG + Intronic
944617840 2:201481299-201481321 CTGGACCCCCTCAAGAATGAAGG + Intergenic
946639236 2:221765661-221765683 CTGCAGTCCCTCAATGCTGATGG + Intergenic
1168749051 20:269206-269228 CTGGAGTAGCTGATTAATGATGG - Intergenic
1170700727 20:18701065-18701087 CTGGATTCTCTCATTAGGGATGG + Intronic
1174526848 20:51179217-51179239 CTGGAGTCCCACGTTATTGTAGG + Intergenic
1179034541 21:37748151-37748173 GTGGTGTCCCTCAATAATGGTGG + Intronic
1180883254 22:19221567-19221589 CTGGAGTCCCAGATTCAGGAAGG - Exonic
1181684064 22:24516341-24516363 CTGGGGCCCCTCATTTAGGAGGG + Intronic
949927973 3:9057223-9057245 CTGGAGTCCCACATGAAAGGTGG - Intronic
952001282 3:28788225-28788247 ATGGATTCATTCATTAATGAGGG + Intergenic
955520132 3:59767597-59767619 CTGGAGCCCAACATTAAGGATGG + Intronic
959277209 3:104291598-104291620 CTGGAGTCCCTCCTACATGGTGG + Intergenic
966505374 3:180695021-180695043 CTGGATTCCCTAATTAGAGATGG - Intronic
971006434 4:22379080-22379102 CTGGATTCCCTGATTTTTGAAGG + Intronic
971213971 4:24646658-24646680 CAGGAGCCCATCATTTATGAAGG - Intergenic
973972388 4:56226454-56226476 CTGGAGTCCCTAAGGAATGGAGG - Intronic
975118890 4:70707075-70707097 CTGGACTCCCTCATTGTTAAAGG + Intronic
976321776 4:83725021-83725043 CAGGAATGCCTCATTAATAAGGG + Intergenic
976621827 4:87136226-87136248 GTGGAGTCCTTCATTACTTATGG - Exonic
977463343 4:97354091-97354113 CTGGAGTAATTCATTCATGAGGG + Intronic
979189465 4:117838284-117838306 CTGCAGTCCCTCTTGACTGATGG + Intergenic
984899175 4:184569615-184569637 CTGGAGTCCTTCATCAACGAAGG + Intergenic
986415810 5:7526825-7526847 CTGGAATCCCTTAATGATGAAGG + Intronic
989251455 5:39319995-39320017 CTGGACACACTGATTAATGAAGG + Intronic
994337661 5:98587371-98587393 ATGGAGTCTCTCAGTAATGACGG - Intergenic
994968314 5:106702524-106702546 CTAGAATCCCTCATGAATCAAGG - Intergenic
996060152 5:119024068-119024090 CTGTTGTCCCTCACTTATGAAGG - Intergenic
1002979555 6:2122506-2122528 CTGCAGTCCCTGATTATTGAAGG - Intronic
1010142292 6:72625080-72625102 CTGAAGTACCTCATTAATCACGG - Intronic
1014755121 6:125294020-125294042 CTGGAGTAACTCATAAATAAAGG - Intronic
1016205409 6:141462008-141462030 CTGAAGTACCTCATCAATTATGG + Intergenic
1019628198 7:2032130-2032152 CGGGCGTCCCGCATGAATGAGGG - Intronic
1022839669 7:34151094-34151116 CTGGAGTCCACCATGCATGAGGG + Intronic
1029603373 7:101583185-101583207 CTGGGGTCCCTCAGGGATGAGGG + Intergenic
1030423939 7:109347662-109347684 ATGTAGTCCCTCATTAATACAGG + Intergenic
1039150031 8:34494164-34494186 CTGTAGTGCCTAATTAATTAGGG - Intergenic
1039920347 8:41889356-41889378 CTGGAGACCCTCATAAGTGCAGG + Intronic
1041992117 8:64005917-64005939 CTGGGGTCCAGCATGAATGAGGG - Intergenic
1043944487 8:86233872-86233894 CTAGCTTCCCTCATTAATGTGGG + Intronic
1044186339 8:89255892-89255914 CTGAAGTCCCCAATTATTGAGGG + Intergenic
1050335729 9:4588483-4588505 CTGGAATACCTCAGTCATGAGGG + Intronic
1052822471 9:33148533-33148555 CAGGAGTCCCTCATTACAGAAGG + Intronic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1059149593 9:111937497-111937519 CTGGTGTCCGTCAGTCATGAGGG - Intergenic
1187114000 X:16330949-16330971 CTGGATTCACTGATTAATGGTGG - Intergenic
1187117584 X:16368708-16368730 ATGGAGTCCCTCCTTAAAAAAGG - Intergenic
1188066351 X:25665124-25665146 CTGGAGTCCAGAATGAATGAAGG + Intergenic
1198093133 X:133351580-133351602 CTGGGGTGCCTCACTAATAAAGG - Intronic