ID: 910614324

View in Genome Browser
Species Human (GRCh38)
Location 1:89180391-89180413
Sequence TTGACTGAGGGCCCTTTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910614324_910614333 30 Left 910614324 1:89180391-89180413 CCTGCAAAAGGGCCCTCAGTCAA 0: 1
1: 0
2: 0
3: 9
4: 140
Right 910614333 1:89180444-89180466 TGTATTTGACCATATATTTGGGG 0: 1
1: 0
2: 4
3: 49
4: 478
910614324_910614331 28 Left 910614324 1:89180391-89180413 CCTGCAAAAGGGCCCTCAGTCAA 0: 1
1: 0
2: 0
3: 9
4: 140
Right 910614331 1:89180442-89180464 GTTGTATTTGACCATATATTTGG 0: 1
1: 0
2: 1
3: 24
4: 187
910614324_910614327 1 Left 910614324 1:89180391-89180413 CCTGCAAAAGGGCCCTCAGTCAA 0: 1
1: 0
2: 0
3: 9
4: 140
Right 910614327 1:89180415-89180437 AGAATACTAGTTGACAACCCAGG 0: 1
1: 0
2: 0
3: 3
4: 135
910614324_910614332 29 Left 910614324 1:89180391-89180413 CCTGCAAAAGGGCCCTCAGTCAA 0: 1
1: 0
2: 0
3: 9
4: 140
Right 910614332 1:89180443-89180465 TTGTATTTGACCATATATTTGGG 0: 1
1: 0
2: 5
3: 66
4: 601
910614324_910614328 2 Left 910614324 1:89180391-89180413 CCTGCAAAAGGGCCCTCAGTCAA 0: 1
1: 0
2: 0
3: 9
4: 140
Right 910614328 1:89180416-89180438 GAATACTAGTTGACAACCCAGGG 0: 1
1: 0
2: 0
3: 6
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910614324 Original CRISPR TTGACTGAGGGCCCTTTTGC AGG (reversed) Intergenic
900627494 1:3615670-3615692 GTGGCTCAGGGCCCTCTTGCAGG - Intergenic
908928852 1:69291325-69291347 GTGACTGTGGGCCCTTTATCAGG - Intergenic
910614324 1:89180391-89180413 TTGACTGAGGGCCCTTTTGCAGG - Intergenic
920268161 1:204742476-204742498 ATGACTGAGGCCCCTACTGCTGG - Intergenic
920788932 1:209070350-209070372 TCTACTGAGGGCCCTCTTCCTGG + Intergenic
924432737 1:244010364-244010386 TTGGCTGAGGCCCCTGCTGCAGG + Intergenic
1063470555 10:6281208-6281230 TTGACTGATGGGCCTTTGGTTGG + Intergenic
1067044198 10:42975245-42975267 GTGACTGATGGCCCATTTGGTGG - Intergenic
1067344733 10:45429024-45429046 TTGACTGGGGGCCCTTGGTCAGG - Intronic
1067350370 10:45470319-45470341 AGGACTGAGGGCCCGTCTGCTGG + Intronic
1069745162 10:70710344-70710366 TTGAGTGAGGCCTCTTTTGAAGG + Intronic
1072429736 10:95360271-95360293 GTGACTGAGGTCTCTTTTGAAGG + Intronic
1074228533 10:111511615-111511637 TTGACCCAGGGCCCTGGTGCAGG + Intergenic
1075930636 10:126292397-126292419 TGGAATGAGGGCCATGTTGCAGG - Intronic
1076109490 10:127849972-127849994 CTGACGGATGGCCTTTTTGCAGG - Intergenic
1080975443 11:37334276-37334298 GTGACTGAGGGCCCTTTGCTGGG + Intergenic
1082659743 11:55895347-55895369 TTGACAAAGGCCCCTTCTGCTGG + Intergenic
1083600490 11:63944518-63944540 ATGACTGAGGGTCCTTATGAGGG - Intronic
1085747076 11:79124081-79124103 TTGACTGTGGGTCCGTTGGCAGG + Intronic
1087700647 11:101432734-101432756 TTGACTGAAGCCATTTTTGCAGG - Intergenic
1089261870 11:117229255-117229277 TTGCCTGAGGGACCATTTCCCGG - Intronic
1095948315 12:47766480-47766502 TTTACTGAGGGAGCTGTTGCTGG - Intronic
1096470605 12:51873315-51873337 TTAACTGACTGCCCTTTTGGTGG + Intergenic
1097964586 12:65565078-65565100 TTGCCTCAGGGACTTTTTGCAGG - Intergenic
1101280230 12:103246352-103246374 TTTACTGAGGGAAGTTTTGCTGG + Intronic
1101528017 12:105549247-105549269 TTGACTGAGGGCTCTGCTGCTGG + Intergenic
1101738120 12:107478840-107478862 GGGACTGAGGGCCATTTTGAGGG - Intronic
1103048624 12:117760289-117760311 TTGACAGAGGACCCCTTTGGGGG - Intronic
1106280959 13:28270473-28270495 TTCAGTGAGAGCCCTATTGCTGG + Intronic
1106497323 13:30292204-30292226 TTGTTTCAGGACCCTTTTGCTGG - Intronic
1108038444 13:46316460-46316482 TTGGGTGAGGGCCCATTTCCTGG + Intergenic
1108576683 13:51797109-51797131 ATGACTGAGGGTCCTTTTGGGGG + Intronic
1110257175 13:73445120-73445142 TTGACGATGGCCCCTTTTGCTGG + Intergenic
1113554474 13:111220664-111220686 TGGACTGTGGGCCCTTGAGCTGG + Intronic
1123116686 14:105898032-105898054 GTCACCGAGGTCCCTTTTGCTGG + Intergenic
1125470735 15:40001021-40001043 GTGGCTGTGGGCCGTTTTGCTGG - Exonic
1128215820 15:65933419-65933441 TTGCCTGTGAGCCCTGTTGCAGG + Intronic
1128761403 15:70218413-70218435 ATGATTGAAGGCCCATTTGCAGG + Intergenic
1130177771 15:81592927-81592949 TTTGGTGAGGGCCCTTTTCCTGG - Intergenic
1131135132 15:89928675-89928697 TTGACTCAGGGACCTTCTCCCGG - Intergenic
1131307496 15:91258399-91258421 TTGACTGACTGCTCCTTTGCAGG + Exonic
1131425666 15:92343750-92343772 TTGTCCAAGGGCCCTATTGCGGG + Intergenic
1133477554 16:6138167-6138189 ATGACTTAGGGCCCATTTGATGG + Intronic
1133506062 16:6413656-6413678 TTGAATGAGAGCCATTTTGTTGG + Intronic
1133535122 16:6694556-6694578 TTCACTGAGGGCCTCTTTACTGG + Intronic
1133628926 16:7600187-7600209 TTCTCTGAGTTCCCTTTTGCAGG - Intronic
1136478804 16:30528719-30528741 TTGACTGTGGGCTCTAGTGCTGG - Intronic
1139435891 16:66936149-66936171 TTGTCTGAGGCCCCTTTGGAGGG - Intronic
1139438266 16:66949196-66949218 TTGTCTGAGGCCCCTTTGGAGGG - Intergenic
1141147595 16:81542649-81542671 TTGGGTGAGGGCCCTCTTCCTGG + Intronic
1143282068 17:5762291-5762313 TTTAATGAGGGCTCTTTTCCTGG - Intergenic
1144393857 17:14824269-14824291 ATGAGTGAGGGCCATTTTGGAGG - Intergenic
1147476323 17:40715125-40715147 TATACTGATGGCCCTTTTTCTGG + Intergenic
1151579850 17:74971854-74971876 CTGACTGAGGGCCATCCTGCGGG + Intronic
1153323737 18:3797413-3797435 TCTGCTGAGGGCCCTTTTCCTGG - Intronic
1158700645 18:59742839-59742861 TTTACTGAGGGAATTTTTGCTGG + Intergenic
1164763918 19:30748595-30748617 TTTAGTGAGGTCCCTTTTCCTGG + Intergenic
924960972 2:34273-34295 CTGGCTGATGGCCCATTTGCTGG - Intergenic
925033147 2:666775-666797 TTTACTGAAGCCCCTCTTGCTGG - Intergenic
925486933 2:4345506-4345528 AGGACTGAGGTCCCTGTTGCTGG - Intergenic
925769392 2:7267424-7267446 CTGACTGAGTGCCCGTCTGCTGG + Intergenic
928844122 2:35648664-35648686 TTGAACGAGGGCCTTTTTGATGG + Intergenic
930469988 2:51800447-51800469 TTGATTGAGGGCATTTATGCTGG - Intergenic
935600255 2:104915218-104915240 TTGACAGAGTGCCCTGTTTCAGG + Intergenic
936241100 2:110789507-110789529 TCCAGTGAGGGCCCTTTTCCTGG + Intronic
939490911 2:142875231-142875253 TTGACTGCTGGCCCTGTAGCGGG + Intergenic
939953813 2:148508107-148508129 TGGGCTGGGGCCCCTTTTGCAGG - Intronic
941621319 2:167782394-167782416 TTGACTCCTGGCCCCTTTGCTGG - Intergenic
945683283 2:212938704-212938726 TTGGCTTAGGGCCCATTTGTAGG - Intergenic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
947151852 2:227123619-227123641 TTGGCTGAGGGCCCTGGTGATGG + Intronic
948667783 2:239546939-239546961 CTGAATCAGGGCCCTTGTGCAGG - Intergenic
948694426 2:239726037-239726059 ATGTCTGAGAGGCCTTTTGCAGG - Intergenic
1169418840 20:5442853-5442875 TTTACTGAGGGCCTTTGTGCTGG + Intergenic
1170464563 20:16610897-16610919 TTGACTGGGTGCCCCTCTGCTGG - Intergenic
1171306585 20:24112342-24112364 GTGACTGAGGGCACCTATGCAGG - Intergenic
1171393023 20:24813617-24813639 ATGGCTGAGGGCTCTTCTGCTGG - Intergenic
1173468441 20:43303028-43303050 TTGGCTCAAGGCCTTTTTGCAGG + Intergenic
1175718402 20:61270807-61270829 TTGAGTGATGGCACCTTTGCGGG + Intronic
1177036279 21:16047158-16047180 TTTGGTGAGGGCCCTTTTCCTGG + Intergenic
1180877106 22:19179635-19179657 TGGACTGTGGGCCCTCCTGCTGG - Exonic
952531345 3:34265283-34265305 TTGACTGAGGGCCAATTTTCCGG - Intergenic
953799232 3:46009199-46009221 TTGACTCAGAGCCTTTGTGCTGG - Intergenic
958103038 3:89037553-89037575 TAGAGTGTGGCCCCTTTTGCAGG - Intergenic
958862741 3:99465184-99465206 TTGACTGATGAGCCTTTTGAAGG - Intergenic
960984249 3:123263285-123263307 CTTGCTGAGGGCCCTTTTCCTGG + Intronic
962665639 3:137651126-137651148 ATGACTGACAGCCCTTTTGGGGG - Intergenic
970295366 4:14624059-14624081 TTGCCTGAGGGCACTTTTCCTGG + Intergenic
978425210 4:108574989-108575011 CTGACAGTGGGCCCTTTTGTGGG + Intergenic
981708880 4:147689334-147689356 TTGACTAAGAGCCCTTCAGCTGG - Intergenic
981757335 4:148154757-148154779 TTGACCGAGGGTTCTTTTGCAGG + Exonic
983037278 4:162882805-162882827 TTGCTTGTGGGCCCTTGTGCTGG - Intergenic
986687804 5:10289424-10289446 TTCACGGAGGGTCCTTTAGCAGG - Intronic
986942969 5:12979031-12979053 CTCACTGAGGCCCGTTTTGCAGG - Intergenic
987712534 5:21521039-21521061 TTTGGGGAGGGCCCTTTTGCAGG + Intergenic
988301888 5:29439744-29439766 TTTGGGGAGGGCCCTTTTGCAGG - Intergenic
989501603 5:42175192-42175214 TCTGCTGAGGGCCTTTTTGCTGG + Intergenic
990477958 5:56180054-56180076 TTGGGTGAGGGCCTTTTTGGTGG + Intronic
990559268 5:56967205-56967227 TTTGGTGAGGGCCCTTTTCCTGG - Intronic
991582472 5:68171197-68171219 TTGTCTTTGGGCCCTTTCGCAGG + Intergenic
991958498 5:72019154-72019176 TTTACTGAGAGCTATTTTGCTGG + Intergenic
992610213 5:78501410-78501432 CTGGCTGAGGGCCCTTCTGCGGG + Intronic
998315660 5:141180216-141180238 GTGCCTGAGGGCCCCTTTCCAGG + Exonic
998316202 5:141184738-141184760 ATGCCTGAGGGCCCCTTTCCAGG + Exonic
998319026 5:141211086-141211108 GTGCCTGAGGGCCCCTTTCCAGG + Exonic
998951452 5:147396389-147396411 TTGACTGTAAGCCCCTTTGCAGG - Intronic
999473488 5:151877011-151877033 TCTAGTGAGGGCCCTTTTCCTGG - Intronic
1000793212 5:165632340-165632362 TTGACGGAGAGCCCTTTTGGTGG - Intergenic
1003424414 6:5988169-5988191 TTCACTGGAGGCCCTTTTGGAGG + Intergenic
1003974410 6:11329125-11329147 TTGTCTTAGGGCCCTCTTGAGGG - Intronic
1007408047 6:41646088-41646110 ATGACTGAGGTCCATTTTCCTGG - Intronic
1007730263 6:43941259-43941281 TGGCCTGAGGGCCCTTCTCCTGG + Intergenic
1008600880 6:53092914-53092936 AATACTGAGGGCCATTTTGCGGG - Intronic
1011529808 6:88309477-88309499 TTTGGTGAGGGCCCTTTTCCAGG - Intergenic
1016233458 6:141833177-141833199 TGGACAATGGGCCCTTTTGCTGG + Intergenic
1017202630 6:151772571-151772593 ATGATTGAGGCCCCTTTTGAGGG + Intronic
1018586374 6:165364363-165364385 TTGAGTGAGGGCCTGTTTTCTGG - Intronic
1019637719 7:2085048-2085070 CTGACTGCTGGCCCTTTAGCAGG - Intronic
1021689379 7:23217374-23217396 TTCACTGAGGATCCTTTTGAAGG - Intergenic
1023267625 7:38424183-38424205 TTGACTGTGGGCATTGTTGCAGG - Intronic
1023480693 7:40630716-40630738 TAGACTGAGAGCCCTTTTGGGGG - Intronic
1024631426 7:51250827-51250849 TTGACTGGGAACCCTTATGCTGG + Intronic
1028485072 7:91348616-91348638 TTTATTAAGGGCCCATTTGCTGG - Intergenic
1028527975 7:91806372-91806394 TCCACTGAGGGTCCTGTTGCAGG - Intronic
1030848463 7:114453522-114453544 TTGACTGAGGACCTTCTTGGTGG + Intronic
1037930851 8:22879363-22879385 TTTACTGAGTGCCCTTTTTTCGG - Intronic
1038681890 8:29676253-29676275 TCGAGTGAGGGCCTTCTTGCTGG - Intergenic
1040009762 8:42651667-42651689 GTGACTGAGGGGCCTTTCGGGGG + Intergenic
1041487631 8:58396440-58396462 TTGGGTGAGGGTCCTTTTCCTGG - Intergenic
1043435925 8:80236408-80236430 TTGACTGAGGGCTCATTTTGGGG - Intergenic
1043494160 8:80781781-80781803 TAAACTGAGGGCCATTGTGCTGG + Intronic
1046997243 8:120537361-120537383 TTGACTGAGTGGTGTTTTGCTGG - Exonic
1047647331 8:126882526-126882548 TTGACTGAGGGCTCTTCTCAGGG - Intergenic
1047724936 8:127676193-127676215 CTGCCTCAGGGCCCTTTTCCTGG + Intergenic
1048549596 8:135422091-135422113 TTGTCTGGGGACCCTCTTGCAGG - Intergenic
1050110768 9:2213501-2213523 TAGACTGAGTGCCGTTTTCCAGG - Intergenic
1052561066 9:30084618-30084640 TTTGGTGAGGGCCCTCTTGCTGG + Intergenic
1052625678 9:30973699-30973721 GGGACTCAGGTCCCTTTTGCTGG - Intergenic
1056720083 9:89063997-89064019 TCTACTGAGGGCCCTCTTCCTGG + Intronic
1057106800 9:92427062-92427084 TTTGCTGAGTGCCCTTTTTCTGG - Intronic
1057847096 9:98534070-98534092 TTGACCCAAGGCCCTTTTGGTGG + Intronic
1058131544 9:101259525-101259547 TCTAGTGAGGGCCCTCTTGCTGG + Intronic
1187399596 X:18947747-18947769 TTGACTGATGGGCCTTTGGTTGG - Intronic
1189368823 X:40411832-40411854 TTGCCTGAGGGCTTTTTTTCTGG + Intergenic
1192168358 X:68839897-68839919 ATGACTGAGGGCACCTATGCTGG + Intronic
1193875944 X:86862839-86862861 TAGACTGAGGGCTCTTATGGTGG + Intergenic
1194675927 X:96793568-96793590 TTTGGTGAGGGCCCTTTTCCTGG + Intronic
1199269387 X:145865031-145865053 TTGTCTTAGAGCCCTTTTCCTGG + Intergenic
1199751472 X:150823670-150823692 GTGAGTGAGGGCCTTCTTGCAGG + Intronic
1201320579 Y:12694012-12694034 TTTACTGAGGACCCTTAGGCAGG - Intergenic