ID: 910615382

View in Genome Browser
Species Human (GRCh38)
Location 1:89192063-89192085
Sequence AAGTTAATACAGATATAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 288}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910615380_910615382 1 Left 910615380 1:89192039-89192061 CCTTTATCTGAAAAATCCAGAGT 0: 1
1: 1
2: 0
3: 37
4: 349
Right 910615382 1:89192063-89192085 AAGTTAATACAGATATAACTTGG 0: 1
1: 0
2: 3
3: 14
4: 288
910615379_910615382 22 Left 910615379 1:89192018-89192040 CCATAAATATGTTTAGAGATTCC 0: 1
1: 0
2: 2
3: 17
4: 242
Right 910615382 1:89192063-89192085 AAGTTAATACAGATATAACTTGG 0: 1
1: 0
2: 3
3: 14
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910615382 Original CRISPR AAGTTAATACAGATATAACT TGG Intronic
904098422 1:28000902-28000924 AAGTAAACACAGAAATAGCTGGG + Intronic
904101920 1:28037779-28037801 AGGTAAAAACAGATATAACCAGG + Intronic
905608934 1:39331581-39331603 AGGTTAATACAGTTCTCACTAGG - Intronic
906975152 1:50562000-50562022 AAGTTAGTACAGATATATTATGG + Intronic
909307742 1:74102751-74102773 AAGTCAATAGAGAGATCACTGGG - Intronic
909509001 1:76429797-76429819 AAGTAAATACAGGTAGAAATTGG + Intronic
910615382 1:89192063-89192085 AAGTTAATACAGATATAACTTGG + Intronic
911381243 1:97117518-97117540 AAGTTAATACAGAGACAATTAGG + Intronic
917102513 1:171460408-171460430 AAGTTAATAGGAATCTAACTCGG + Intergenic
917330752 1:173878156-173878178 CAGTTAGGACAGATAAAACTAGG - Intronic
917571493 1:176270205-176270227 ATGTTAACAGAGCTATAACTGGG - Intergenic
918413165 1:184281843-184281865 CAGATAATACACATATAAGTAGG + Intergenic
919074903 1:192801143-192801165 ATGTTAATACAGATAGAAAGTGG - Intergenic
921308272 1:213818570-213818592 AAGTCTATACAGACATACCTTGG - Intergenic
921663854 1:217843025-217843047 ACATTAATAAAAATATAACTGGG - Intronic
922385658 1:225079476-225079498 AACTAAATTCAGAGATAACTTGG + Intronic
923192607 1:231634345-231634367 AAGTAAATACAGAGATAAAACGG + Intronic
1065664563 10:28043734-28043756 AAGCTAATGGAGATATAAATAGG + Intergenic
1066706544 10:38185598-38185620 AAATTAATTCAGTTATAATTTGG - Intergenic
1066785227 10:38995836-38995858 AAATTATTTCAGATATAATTTGG - Intergenic
1066982754 10:42434406-42434428 AAATTAATTCAGTTATAATTTGG + Intergenic
1068542352 10:58309456-58309478 AAGAAAATACTGATATAATTTGG + Intergenic
1069111249 10:64450022-64450044 AAGATAATACAGGTATGACTTGG + Intergenic
1069236313 10:66079456-66079478 AAGAAAATACATATAAAACTAGG - Intronic
1071029058 10:81151580-81151602 AAGTTAATACTTATTTACCTTGG - Intergenic
1071187810 10:83063369-83063391 AAATTAATACAAATAAAAGTGGG - Intergenic
1071544288 10:86516445-86516467 AAGTAAACACAGACAAAACTTGG - Intronic
1071802167 10:89075879-89075901 AAGTTATTTCAGATGAAACTGGG - Intergenic
1072559119 10:96553873-96553895 ATGTAAATAAAGAAATAACTGGG - Intronic
1072566179 10:96618516-96618538 CAATTAATACAAATATAAATAGG - Intronic
1073380010 10:103071045-103071067 CAGTTAGTACAGATATCACAAGG + Intronic
1073679405 10:105686022-105686044 AAATTCATTCAGATATGACTGGG - Intergenic
1074636502 10:115324292-115324314 AACATAATACACAAATAACTGGG - Intronic
1076630687 10:131850224-131850246 AAGTTAATGCAGATGGACCTCGG + Intergenic
1077344791 11:2041662-2041684 AAGGTAATGCAGATACCACTGGG + Intergenic
1078794795 11:14581722-14581744 AAGTTACTACAGATAATCCTGGG - Intronic
1078974033 11:16450543-16450565 AAGTTAATACAACTACAAGTCGG + Intronic
1079044187 11:17085157-17085179 TAGTTAATACAGATGGAACAAGG + Intronic
1080238191 11:30096434-30096456 AAGTCTATAAAGAAATAACTAGG + Intergenic
1080373785 11:31684085-31684107 AAGCTACTACAAATATAAATTGG + Intronic
1080593982 11:33751956-33751978 AAGAAAATACAGCTATGACTAGG + Intronic
1081137633 11:39458773-39458795 ACGTCAACACAGAAATAACTGGG + Intergenic
1082143399 11:48635980-48636002 AATTTAATTCAGATATCTCTTGG - Intergenic
1082254313 11:50015587-50015609 AAGTTAAAACAGAAAAATCTGGG - Intergenic
1084994135 11:72958715-72958737 AAGTGACTATAGATAAAACTTGG - Intronic
1085150372 11:74247831-74247853 AAGATAATCCAGATATAAAAAGG + Intronic
1086590647 11:88510035-88510057 AAGTTGGTATATATATAACTAGG + Intronic
1087206070 11:95395202-95395224 TAGTTATCACAGATATTACTAGG - Intergenic
1087402624 11:97686326-97686348 AAATCAAAACAGATATTACTTGG - Intergenic
1087527070 11:99328948-99328970 AAGTAAATACATGTATAAGTTGG + Intronic
1087877652 11:103376594-103376616 AAGATAACACAAATATAAATGGG - Intronic
1087976639 11:104557372-104557394 AAGTCAATGCAGATATAGGTGGG + Intergenic
1088381541 11:109198738-109198760 AAGATAATAAAGATAGATCTGGG - Intergenic
1088643594 11:111897534-111897556 AATTAAATAAAGATATACCTCGG - Intergenic
1090217008 11:124977446-124977468 AAATTACTACAAATATAAATAGG - Intronic
1202827777 11_KI270721v1_random:96852-96874 AAGGTAATGCAGATACCACTGGG + Intergenic
1092938269 12:13384343-13384365 AAGTGAATACAAATAAAACTAGG - Intronic
1093317387 12:17667747-17667769 ATGTTAAAACAGATATATCTGGG + Intergenic
1094214979 12:27931137-27931159 AAGGATATACAGATATAAATTGG - Intergenic
1095323512 12:40859148-40859170 AATTTAAAACAGATATAAAGAGG + Intronic
1098043453 12:66376552-66376574 AAGTTAATACAGATGGAATCAGG + Intronic
1098341296 12:69454122-69454144 AAGTTCAAACCGGTATAACTGGG + Intergenic
1098485716 12:71019302-71019324 ATGTTAATACACATATTGCTGGG + Intergenic
1098487044 12:71033459-71033481 AAGTTAATACACATACCACAAGG + Intergenic
1098650942 12:72967723-72967745 AAGTTTATACACATGTAGCTTGG + Intergenic
1098822865 12:75254777-75254799 AAGTTAATACTAATAAATCTTGG + Intergenic
1099191260 12:79564254-79564276 AAGATAATACAGATTTAAAGAGG - Intergenic
1099336892 12:81372937-81372959 AAGTTGATATATATATATCTTGG - Intronic
1099558558 12:84143722-84143744 AAGTTATTACAGGTACCACTGGG - Intergenic
1099847876 12:88052200-88052222 AAGATAGTTCAGATATAAATTGG + Intronic
1100167233 12:91929747-91929769 CAGTTAATACAAATATATCAAGG + Intergenic
1101562304 12:105869215-105869237 GAGTTATAATAGATATAACTTGG - Intergenic
1101894661 12:108746955-108746977 ATGTTAATACAGAGGTAACTGGG + Intergenic
1106191801 13:27459887-27459909 AAGTTAATAAATAGATAAATAGG + Intergenic
1107220861 13:37978357-37978379 TAGTTAATACAAAAACAACTAGG + Intergenic
1107389343 13:39946958-39946980 AAGTTAATATTGATATATGTAGG - Intergenic
1107813567 13:44223241-44223263 AAGTTAATAAAAGTATAAATTGG - Intergenic
1108530692 13:51324727-51324749 AACTTAATACAGATATTTGTTGG + Intergenic
1108860762 13:54855968-54855990 AATTTAATATAGCTAAAACTTGG + Intergenic
1109152946 13:58867340-58867362 TAATTACTACAGATATAAATGGG + Intergenic
1109361057 13:61294991-61295013 AGGTTAACAAAGAAATAACTTGG - Intergenic
1109497952 13:63198850-63198872 AAGTTAGTACAGAGGTAACATGG - Intergenic
1110509843 13:76336440-76336462 TAGGTAATACAGAAAAAACTAGG - Intergenic
1110796657 13:79646158-79646180 AAGTTAATGCAGCTATTACATGG - Intergenic
1112545570 13:100366048-100366070 AGGTTAATAAAGATGTAACTTGG + Intronic
1112670821 13:101635946-101635968 CATTTAAAACAGACATAACTTGG - Intronic
1113260303 13:108554132-108554154 AAGTTAAGGCAGAATTAACTTGG - Intergenic
1113994010 14:16052485-16052507 AAGTTAATAAATAGATAAGTAGG - Intergenic
1114856353 14:26449402-26449424 AAGTTAATAAAGATAACAGTAGG + Intronic
1115100531 14:29692827-29692849 AAGTTATTTGAGATATAACTTGG + Intronic
1116045522 14:39738975-39738997 AAATTAATATAAATATAATTAGG - Intergenic
1116175093 14:41459083-41459105 GAGTTAATCCAGACAGAACTGGG - Intergenic
1117382004 14:55173899-55173921 CAGTTAATACAGTTATTACAGGG - Intronic
1119343732 14:73903815-73903837 AAGTGCATACAAAGATAACTGGG + Intronic
1120022348 14:79545122-79545144 AAGCTAATACAGAAATCAATGGG - Intronic
1120317347 14:82912659-82912681 AAGATTTTACAGATATAGCTGGG + Intergenic
1124382790 15:29181108-29181130 AAATTAAAAAAGACATAACTAGG + Intronic
1126255235 15:46617478-46617500 AAGATATTACAACTATAACTTGG - Intergenic
1126818311 15:52475931-52475953 AAGTTAATAAGGATATATCCAGG - Intronic
1127203445 15:56684913-56684935 AATTTTATAATGATATAACTTGG - Intronic
1128636510 15:69305799-69305821 AAGTTAATAAACAGCTAACTTGG - Intronic
1130241687 15:82199254-82199276 AAGTTAATTCTAATATACCTGGG - Intronic
1133926730 16:10199153-10199175 AAGTTAAGACAATTAAAACTTGG - Intergenic
1134340353 16:13339219-13339241 AAGTTATGACAGCTCTAACTTGG - Intergenic
1141773202 16:86103911-86103933 AATTGAAAACAGAAATAACTTGG - Intergenic
1145857571 17:28176757-28176779 AAGTTAATCCAGACAAGACTAGG - Intronic
1148828856 17:50415935-50415957 CAGTTAATAAAAATATAAATTGG - Intergenic
1150176961 17:63067210-63067232 AAATTGATACAGAAAGAACTAGG + Intronic
1150305438 17:64080886-64080908 AAGTTATTACCGGTACAACTTGG - Intronic
1153122988 18:1753978-1754000 TAGTTAATAAAGATATGAGTGGG - Intergenic
1153897946 18:9585479-9585501 CAGTTAATACAGAAAGAAATGGG + Intronic
1155439189 18:25843549-25843571 CAGATAGTACAGATATAACAAGG + Intergenic
1156161853 18:34369245-34369267 AAGTTGATAGAGATATAAAATGG - Intergenic
1158836748 18:61338401-61338423 AAGTTAATCCATATGTAATTAGG - Intronic
1159489840 18:69117738-69117760 AAATTAATACAAATATAAAGTGG + Intergenic
1159680548 18:71345839-71345861 AAGGTAATAGAGATAGAAGTGGG + Intergenic
1160162538 18:76484729-76484751 AAGTTATTACAGTTAGAATTTGG - Intronic
1160335514 18:78035349-78035371 AAGTAAAAGCAGAGATAACTGGG + Intergenic
1164611892 19:29638094-29638116 AATTTAATTCAAATATAACCAGG - Intergenic
1164805918 19:31116577-31116599 AAATAAATACATAAATAACTAGG - Intergenic
1166094028 19:40528728-40528750 AAGTAAAGACAGACATACCTAGG - Intronic
927285133 2:21349441-21349463 GACTTAAAACAGATATATCTGGG + Intergenic
929369623 2:41206844-41206866 AAGTTAATAGAAATTTGACTTGG + Intergenic
931936925 2:67208976-67208998 AGGTTAATACTGATAGAACAAGG + Intergenic
932240295 2:70151049-70151071 AAGTTAAAACATATATATTTAGG + Intronic
932977227 2:76617826-76617848 AATTTAATAATGATATAACAAGG - Intergenic
933305435 2:80591844-80591866 AAGTTATTACACATATAATGAGG - Intronic
933453536 2:82491067-82491089 AAGTTAATACAGAAATGCCATGG + Intergenic
937017882 2:118622507-118622529 AAGTTAAAACAGACATAACTAGG - Intergenic
938537658 2:132258385-132258407 AAGTTAATAAATAGATAAGTAGG + Intergenic
939115341 2:138054166-138054188 AAGCTAGTACACATGTAACTTGG + Intergenic
941405937 2:165088365-165088387 AAGCTATTACAAATATAACATGG - Exonic
941505150 2:166334454-166334476 GAGGTAATACAAATATAAATTGG - Intronic
942420621 2:175803395-175803417 AACTTAATACTTATATAAATGGG + Intergenic
943176731 2:184485379-184485401 AATTGGGTACAGATATAACTGGG + Intergenic
943684442 2:190803027-190803049 AAATAAATACAGATACAACATGG - Intergenic
944247932 2:197551434-197551456 CAATTAATACAAATATAAATAGG - Exonic
945407120 2:209461928-209461950 AATTTAATCCAGATATAATCTGG + Intronic
947391942 2:229648720-229648742 AAGTTATTACAGATATTATACGG + Intronic
1170166891 20:13368993-13369015 AAATTAATACAGATATATTCAGG + Intergenic
1170312128 20:15003833-15003855 AAGTTATTACAGGAGTAACTGGG - Intronic
1171768421 20:29302326-29302348 AAGTTAATAAATAGATAAATAGG + Intergenic
1171908553 20:30921150-30921172 AAGTTAATAAATAGATAAATAGG - Intergenic
1172616284 20:36287386-36287408 AAATGAATACAGGTAAAACTGGG - Intergenic
1173979239 20:47210469-47210491 AAGTTAATACAAATATAAAAAGG + Exonic
1174884916 20:54323046-54323068 AAGTTAGTACAAATTTAATTTGG + Intergenic
1176553912 21:8244651-8244673 AAGTTAATAAATAGATAAATAGG - Intergenic
1176572834 21:8427675-8427697 AAGTTAATAAATAGATAAATAGG - Intergenic
1176580743 21:8472236-8472258 AAGTTAATAAATAGATAAATAGG - Intergenic
1176726022 21:10433252-10433274 AAGTAAATACAGGCATACCTTGG + Intergenic
1177298352 21:19206167-19206189 AATTTTATACAGACATACCTTGG + Intergenic
1177948484 21:27503093-27503115 AATTTAATAAAGATATAAAATGG - Intergenic
1180288350 22:10773861-10773883 AAGTAAATACAGGCATACCTTGG - Intergenic
1180313258 22:11255030-11255052 AAGTTAATAAATAGATAAGTAGG + Intergenic
1180341986 22:11627335-11627357 AAGTTAATAAATAGATAAATAGG - Intergenic
1181894987 22:26099363-26099385 AAGTAAATACATAAATAAATAGG - Intergenic
1183609211 22:38886289-38886311 AAGTAAATACATAAATAATTAGG + Intergenic
1203258916 22_KI270733v1_random:161683-161705 AAGTTAATAAATAGATAAATAGG - Intergenic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
951304783 3:21045420-21045442 ATGATAATACAGGTAAAACTAGG - Intergenic
952359549 3:32615930-32615952 AATTTAATACAGTTATAAAGGGG - Intergenic
952369261 3:32704070-32704092 AAGTTAATTTAGAGATAAGTAGG + Intronic
952610630 3:35204878-35204900 AAATTAAAATGGATATAACTTGG - Intergenic
956235444 3:67065108-67065130 AGGTTAATACTGATATTACATGG + Intergenic
956582516 3:70830255-70830277 AAGTTAGTACAAATATACCTGGG + Intergenic
957146189 3:76426891-76426913 AACTTCATTCATATATAACTGGG - Intronic
957210272 3:77249682-77249704 AAGTTAGCAAATATATAACTAGG - Intronic
957357155 3:79105063-79105085 AAGTTAATACAAAAAAATCTAGG + Intronic
957667944 3:83260619-83260641 AAGTAAATACAAAAATAGCTTGG + Intergenic
957802960 3:85108911-85108933 AGGTTAATTAAGACATAACTAGG + Intronic
959287191 3:104429802-104429824 AGATAAATACAGATATAAATAGG - Intergenic
959355913 3:105328174-105328196 AAGTTATTACAAGTATACCTTGG - Intergenic
959481248 3:106874939-106874961 AAGTTATTTAAGAAATAACTTGG - Intergenic
962366766 3:134791962-134791984 CTGCTAATACAGATATACCTGGG + Intronic
962778859 3:138692003-138692025 AAGTGAATACATTTATAAGTGGG + Intronic
963250839 3:143102008-143102030 AATTTCATACAGATATCATTTGG - Intergenic
963470240 3:145731408-145731430 AAATAAATACAAATAAAACTTGG + Intergenic
963843889 3:150135133-150135155 AAGCAAACACAGATAAAACTGGG + Intergenic
963966519 3:151377870-151377892 AAGATAATACAGAAATAAAAGGG + Intronic
966587903 3:181648061-181648083 AAGTTAATACAGTTGTCTCTTGG - Intergenic
966976786 3:185091843-185091865 AATATAATACATATATAGCTGGG - Intronic
967432985 3:189409977-189409999 AAGAAAATACAGATAGAAATAGG - Intergenic
968250669 3:197209076-197209098 AAATTAAAACAAATATGACTTGG + Intronic
970823122 4:20242501-20242523 GAGTTAATTCAAATATTACTAGG + Intergenic
971122154 4:23716633-23716655 ACTGTAATACAGATTTAACTAGG - Intergenic
971431146 4:26569088-26569110 ATGATAATACAGATTTTACTGGG - Intergenic
971535837 4:27750265-27750287 AAGTTATTAGAAAAATAACTAGG + Intergenic
972435237 4:39027501-39027523 AAGTCAAAACAGATAAAATTAGG + Intronic
972889230 4:43535295-43535317 AAGTTAATAAAGCTTGAACTAGG + Intergenic
974320665 4:60344958-60344980 AAGTTAATAAATAGCTAACTTGG - Intergenic
974409881 4:61526179-61526201 AAGTTCATACAGATGTAATAGGG + Intronic
974715310 4:65661907-65661929 AAGTGAAAAAATATATAACTGGG + Intronic
976333518 4:83859312-83859334 AAGTTAGTACTGATACAACTTGG + Intergenic
977086972 4:92612599-92612621 AAATTAAAGCAGATATAAATAGG - Intronic
978043491 4:104098542-104098564 AAGCTAATAAAGACATACCTGGG - Intergenic
978269864 4:106875822-106875844 AAGTTAATAAATATATAATTTGG + Intergenic
978959776 4:114662688-114662710 AAGTTAATACAGATCTCTTTAGG + Intronic
980483691 4:133425019-133425041 AAGTTATCCCACATATAACTAGG - Intergenic
980582995 4:134776894-134776916 CACTTAATACAGAAATTACTTGG - Intergenic
980740000 4:136938082-136938104 TAGTAAATGCAGATATAAATTGG - Intergenic
982751271 4:159165366-159165388 AAGTCAATACATTTTTAACTTGG + Intronic
982876170 4:160653260-160653282 AACTTAGTACAGACATACCTTGG - Intergenic
982994671 4:162327048-162327070 AAGATAATTCAGATATAGTTGGG + Intergenic
984829477 4:183958303-183958325 GAGTTCATAGAGATATCACTGGG + Intronic
985290946 4:188386925-188386947 AAGTTAATACCTTTAAAACTTGG - Intergenic
986544132 5:8876808-8876830 AAGTTAATACAGTTATTATGGGG - Intergenic
987661748 5:20887343-20887365 AAGTTAAAACAAAGATAGCTGGG - Intergenic
988104190 5:26722396-26722418 GAGTTAAAACAGATAGAAATAGG - Intergenic
988444019 5:31264738-31264760 AAGTTGATACAAAAAGAACTGGG + Intronic
988901035 5:35732633-35732655 ATGTTAATATGGATATAACCAGG - Intronic
990549215 5:56856223-56856245 AAGTCAATACAGATAGAATCTGG - Intronic
991316654 5:65316477-65316499 ATGTAATTACAGATATAACTAGG - Intronic
992265120 5:75010806-75010828 AAGTGAATACAAAGATAGCTAGG - Intergenic
992385087 5:76276993-76277015 AAGTAAATGAAGATATCACTAGG + Intronic
992456523 5:76921439-76921461 AAGGTAACAGAGATAGAACTAGG + Exonic
994220154 5:97186154-97186176 AAATTAATATAGAGATAAATAGG - Intergenic
995143301 5:108758324-108758346 AAATTCATACAGCTATTACTAGG - Intronic
996233470 5:121096143-121096165 AATTTAAAACAGTTATGACTAGG + Intergenic
996464504 5:123783728-123783750 AAGAAAAGACAAATATAACTAGG - Intergenic
997776277 5:136609567-136609589 AAATTAATAAAGAAATAATTGGG + Intergenic
998449754 5:142225222-142225244 AAGTAAAAACAAATGTAACTGGG - Intergenic
998861675 5:146450146-146450168 AAGATAATACAGAAGTAAATGGG + Intronic
1000387836 5:160692203-160692225 AAAGTAAAGCAGATATAACTTGG + Intronic
1001373435 5:171230427-171230449 AAGTTACTACATAACTAACTGGG - Intronic
1002458543 5:179360476-179360498 AAGTCAATGAAGATATAGCTTGG - Intergenic
1004084716 6:12434608-12434630 ATGTAATTACAGATATAATTGGG + Intergenic
1004958263 6:20755204-20755226 AAGATAATACAGACATGAATAGG - Intronic
1005797634 6:29383633-29383655 AAATGAATACAAATAAAACTGGG + Intronic
1005849494 6:29810781-29810803 AAATTTATACAGTTATAAGTTGG - Intergenic
1006975801 6:38099753-38099775 AAGTAAATACATATATACCTTGG - Intronic
1008840860 6:55902463-55902485 AAGGTCATACACATATTACTTGG + Intergenic
1009771581 6:68150573-68150595 TATTTAATAGAGATAGAACTTGG + Intergenic
1012071289 6:94620487-94620509 AAGTTAATAGGGTTATATCTAGG - Intergenic
1012816433 6:104028049-104028071 AAGTTAGTACAGGTAAAACGAGG - Intergenic
1013086217 6:106860026-106860048 AAGATAAAACAGATATAACTTGG - Intergenic
1013752721 6:113425737-113425759 AATTTAATACACAGAAAACTGGG - Intergenic
1013831705 6:114280318-114280340 AAGTTAAGAAAGATTTAACAGGG + Intronic
1015140983 6:129931410-129931432 AAATTAATACAGATAAAATTTGG + Intergenic
1015463307 6:133518307-133518329 AAATAAATAAAGATATAACAAGG + Intronic
1015957769 6:138615880-138615902 AAGTCAGTACAGTTATAACCAGG - Intronic
1016721258 6:147301599-147301621 AAGATAATATAGATAAATCTGGG - Intronic
1017226207 6:152023972-152023994 AAGTGAATGCAATTATAACTTGG - Intronic
1017514567 6:155144429-155144451 AAGTTCATTCTGATACAACTAGG + Intronic
1020757422 7:12220694-12220716 AAGTAAATGCAGATGTAATTTGG - Intronic
1022971573 7:35522535-35522557 AAGTTAATACATATTTATGTAGG + Intergenic
1024433459 7:49319391-49319413 TATTTAATACAAATATAATTTGG - Intergenic
1027534734 7:79383415-79383437 TAGTTAATACAGGTATAAAATGG + Intronic
1028203779 7:87993366-87993388 AATTTATTACAGATATCATTAGG - Intronic
1030439382 7:109567768-109567790 AAGTTAATGCCATTATAACTAGG + Intergenic
1030853722 7:114524017-114524039 AAGTAAATTCAAATTTAACTGGG + Intronic
1031550402 7:123104784-123104806 AAGTTAATAGACATAAAACGTGG - Intergenic
1031723963 7:125212947-125212969 AAGTTAAAAAAGACACAACTGGG + Intergenic
1031797014 7:126187309-126187331 AAGCTAATACAAATAGAATTGGG + Intergenic
1032236447 7:130128095-130128117 AACTTAGTTCAGATACAACTAGG + Intronic
1032337204 7:131036417-131036439 ATGTTAATAAAGATATTTCTTGG - Intergenic
1033793582 7:144820891-144820913 AAGGTAATACATAGAAAACTTGG + Intronic
1034611899 7:152378634-152378656 AAGTAAATACAGGCATACCTTGG - Intronic
1036086227 8:5616116-5616138 AATTTAATACATTTATACCTAGG + Intergenic
1036192931 8:6687741-6687763 AAGTGAATTAAGATATAAATGGG + Intergenic
1036499333 8:9298867-9298889 AAGTAAGTTCAGATATAACAAGG + Intergenic
1037061409 8:14514294-14514316 AAGTGACTTCAGATATAAATAGG + Intronic
1041543688 8:59015919-59015941 AAGATAATACAGAAAATACTTGG + Intronic
1042414516 8:68503846-68503868 AACTAAATCCAGATCTAACTGGG - Intronic
1042750988 8:72157466-72157488 AAGTAAATAAAGTTAAAACTTGG - Intergenic
1043325733 8:79048775-79048797 TAGTTAATACAGAGGAAACTGGG + Intergenic
1043581010 8:81714686-81714708 AAGTTAATACGAATACCACTGGG + Intronic
1043626326 8:82264493-82264515 AAGTAATTACAGATATAGTTAGG + Intergenic
1045579610 8:103464272-103464294 AAGTTAATATAGATGTATTTGGG + Intergenic
1045638355 8:104219576-104219598 AAGATAAAACAGATATAACTTGG - Intronic
1045876038 8:106981565-106981587 CAGGTAAAACAGATACAACTTGG - Intergenic
1046260427 8:111759912-111759934 AAGTTGCTAGAGACATAACTTGG + Intergenic
1046669207 8:117039254-117039276 GAGTAAATATAGATATACCTAGG - Intronic
1047622804 8:126624954-126624976 AAGTTGATTCAGAGATAACAAGG + Intergenic
1048694919 8:137015821-137015843 ATATTAATAAAAATATAACTGGG - Intergenic
1051227423 9:14915859-14915881 AAGTTAGTACAGATTTATTTTGG - Intergenic
1052729225 9:32265806-32265828 AAGTTATTTCAGATAGAAATAGG + Intergenic
1054887953 9:70219554-70219576 AATTTTCTACAGATATAAATGGG + Intronic
1055042538 9:71890858-71890880 AAATTAAAACAGAAATCACTGGG - Intronic
1056414110 9:86359784-86359806 AAGTAAATACATAAATAAATTGG - Intergenic
1057377328 9:94536946-94536968 TACTTAAAACACATATAACTAGG + Intergenic
1058568375 9:106311908-106311930 AAGTGATAACAGATTTAACTTGG + Intergenic
1059490747 9:114665585-114665607 CTGTTAATAAAGATATACCTTGG + Intergenic
1203475108 Un_GL000220v1:143698-143720 AAGTTAATAAATAGATAAATAGG - Intergenic
1186909347 X:14145143-14145165 CAATTAATTCAGCTATAACTGGG + Intergenic
1187651092 X:21407375-21407397 TAGTTAAGACAGATGTACCTGGG + Intronic
1188011431 X:25060434-25060456 GAGTGACTACAGTTATAACTGGG - Intergenic
1188642002 X:32517499-32517521 AAGGTAATACACAAATATCTGGG + Intronic
1189405438 X:40718530-40718552 CAATTAATAAAGATAAAACTTGG + Intronic
1189718511 X:43890258-43890280 GAGTTAATACTTATATAAATAGG - Intergenic
1189979128 X:46491478-46491500 AAGGTAAAGCACATATAACTGGG + Intronic
1190272300 X:48875375-48875397 AAGTTAGTACAGATTTATTTTGG - Intergenic
1190828015 X:54035478-54035500 AAAGCAATACAGAGATAACTCGG + Intronic
1191653652 X:63571472-63571494 AATTTATTACTGATACAACTTGG + Intergenic
1192972373 X:76246713-76246735 AGGGGAAAACAGATATAACTAGG - Intergenic
1195238202 X:102923332-102923354 AGGTTAAAACAGAAATAAATGGG + Intergenic
1195461455 X:105130320-105130342 AAGTAAATGCACATATTACTTGG - Intronic
1195747721 X:108135497-108135519 AAGTCAATACAGATTTTCCTTGG - Intronic
1195850693 X:109278887-109278909 AAGTTAATACAGACTGAACGAGG - Intergenic
1195949308 X:110250531-110250553 CAGATAATTCAGATATTACTCGG + Intronic
1197196041 X:123701504-123701526 AAGTCAATAAAGAAATTACTAGG + Intronic
1198545870 X:137692169-137692191 AAGGTAATACATCTATAACAAGG - Intergenic
1198715392 X:139552992-139553014 AAGGTATTACACATATACCTGGG + Intronic
1199090520 X:143686813-143686835 ACCTTAATACAGGCATAACTTGG + Intergenic
1200897053 Y:8386860-8386882 AAGTTAATACAGAGCAAAGTTGG - Intergenic
1200904020 Y:8462903-8462925 AAGTCAATACAGAACTAAGTTGG + Intergenic
1201076684 Y:10195067-10195089 AAGTTAATAAATAGATAAATAGG - Intergenic