ID: 910617546

View in Genome Browser
Species Human (GRCh38)
Location 1:89216190-89216212
Sequence AGGGGAAGAAACTTAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910617546_910617557 6 Left 910617546 1:89216190-89216212 CCATCCTCTAAGTTTCTTCCCCT No data
Right 910617557 1:89216219-89216241 CCACTCCCCCAACAGACCCTGGG No data
910617546_910617558 7 Left 910617546 1:89216190-89216212 CCATCCTCTAAGTTTCTTCCCCT No data
Right 910617558 1:89216220-89216242 CACTCCCCCAACAGACCCTGGGG No data
910617546_910617555 5 Left 910617546 1:89216190-89216212 CCATCCTCTAAGTTTCTTCCCCT No data
Right 910617555 1:89216218-89216240 CCCACTCCCCCAACAGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910617546 Original CRISPR AGGGGAAGAAACTTAGAGGA TGG (reversed) Intergenic
No off target data available for this crispr