ID: 910617918

View in Genome Browser
Species Human (GRCh38)
Location 1:89219838-89219860
Sequence TGAGCTCCAAACAAAGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910617915_910617918 4 Left 910617915 1:89219811-89219833 CCCAGTCAGATTAACATCCAAAA 0: 13
1: 38
2: 68
3: 64
4: 326
Right 910617918 1:89219838-89219860 TGAGCTCCAAACAAAGAGTCTGG No data
910617916_910617918 3 Left 910617916 1:89219812-89219834 CCAGTCAGATTAACATCCAAAAA 0: 11
1: 10
2: 37
3: 91
4: 372
Right 910617918 1:89219838-89219860 TGAGCTCCAAACAAAGAGTCTGG No data
910617914_910617918 8 Left 910617914 1:89219807-89219829 CCGGCCCAGTCAGATTAACATCC 0: 20
1: 34
2: 37
3: 35
4: 93
Right 910617918 1:89219838-89219860 TGAGCTCCAAACAAAGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910617918 Original CRISPR TGAGCTCCAAACAAAGAGTC TGG Intergenic
No off target data available for this crispr