ID: 910621916

View in Genome Browser
Species Human (GRCh38)
Location 1:89264820-89264842
Sequence GGCCCATTTGCTGGTCATAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 1, 2: 2, 3: 4, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910621909_910621916 19 Left 910621909 1:89264778-89264800 CCAGCAGCTCCTGGAGGGTTTCC 0: 2
1: 3
2: 1
3: 40
4: 299
Right 910621916 1:89264820-89264842 GGCCCATTTGCTGGTCATAGTGG 0: 1
1: 1
2: 2
3: 4
4: 104
910621905_910621916 30 Left 910621905 1:89264767-89264789 CCTGTGCAGGTCCAGCAGCTCCT 0: 5
1: 0
2: 2
3: 36
4: 333
Right 910621916 1:89264820-89264842 GGCCCATTTGCTGGTCATAGTGG 0: 1
1: 1
2: 2
3: 4
4: 104
910621912_910621916 10 Left 910621912 1:89264787-89264809 CCTGGAGGGTTTCCATGGGCAGC 0: 1
1: 1
2: 2
3: 9
4: 185
Right 910621916 1:89264820-89264842 GGCCCATTTGCTGGTCATAGTGG 0: 1
1: 1
2: 2
3: 4
4: 104
910621913_910621916 -2 Left 910621913 1:89264799-89264821 CCATGGGCAGCTGCACTTTCTGG 0: 1
1: 1
2: 2
3: 28
4: 279
Right 910621916 1:89264820-89264842 GGCCCATTTGCTGGTCATAGTGG 0: 1
1: 1
2: 2
3: 4
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910621916 Original CRISPR GGCCCATTTGCTGGTCATAG TGG Exonic
900746708 1:4365764-4365786 GGGGCCTTTGCTGGTCACAGTGG - Intergenic
902116182 1:14123655-14123677 GTCCCATTTGCAGGTGATTGCGG - Intergenic
903320748 1:22541720-22541742 GGCACATTTGTTGGTCAGATGGG - Intergenic
904486260 1:30826182-30826204 GGCCCATTTTCTGGTAAGCGGGG + Intergenic
906867863 1:49441848-49441870 GGCCCATTGGGTGATGATAGGGG - Intronic
909060092 1:70869743-70869765 GCCCCATATGCTGGACACAGTGG + Intronic
910599142 1:89011881-89011903 GGCCCATCTGCTGGTCATAGTGG + Exonic
910603510 1:89056988-89057010 GGCCCATCTGCTGTTCATAGTGG + Exonic
910608525 1:89114150-89114172 GGCCCATCTGCTGTTCATAGTGG + Exonic
910615226 1:89190172-89190194 GGGCCATCTGCTGGCTATAGTGG + Exonic
910621916 1:89264820-89264842 GGCCCATTTGCTGGTCATAGTGG + Exonic
910637208 1:89422128-89422150 GGCCCATCTGCTTTTCATAGTGG - Intergenic
916465561 1:165071268-165071290 GGCCCATTTCCTGCTCTTTGGGG - Intergenic
917793396 1:178514147-178514169 GGGTCATTTGCTGATCCTAGTGG + Intronic
919760049 1:201092042-201092064 GGCTCCTTTGCTGCTCATTGGGG + Exonic
921787365 1:219246540-219246562 GGGGCATTTGCTTGTCATAAAGG - Intergenic
922817054 1:228457383-228457405 GGCCCCTTTGATGGACATAAAGG - Exonic
1065134496 10:22654656-22654678 GGTCCAGCTGCTGGTCATGGTGG + Intronic
1065284353 10:24173253-24173275 GTCCCATTTGGGGGTGATAGGGG - Intronic
1069584204 10:69586605-69586627 AGCATCTTTGCTGGTCATAGTGG - Intergenic
1072535129 10:96356512-96356534 GGCCCATTGGCTGGTCTATGTGG - Intronic
1072944294 10:99796073-99796095 GGCACAGTGGCTGGACATAGTGG + Intronic
1073223955 10:101900692-101900714 GGCGAATTGGCTGGTCACAGTGG + Intronic
1073501927 10:103947513-103947535 AGCCCATTAGCTGGGCATGGTGG + Intergenic
1074061147 10:109966874-109966896 GGCCCATTTGCAGTTCAGTGGGG + Intergenic
1083986884 11:66221358-66221380 GCCCCATTGGCTGGGCATGGTGG + Intronic
1086108506 11:83173156-83173178 GGCCCATATGCTGTTTACAGAGG - Intronic
1087022445 11:93616867-93616889 AGCTCATTTGCTGGTGATGGGGG - Intergenic
1090270689 11:125383904-125383926 GTCCCATTTGCTGGGCAAGGAGG - Intronic
1099183278 12:79491802-79491824 GGCCCATTGGGTGATCACAGGGG + Intergenic
1100492347 12:95093258-95093280 GGGCCATTGGCTGGGCATGGTGG + Intronic
1101112974 12:101504474-101504496 GACCCATTGGCTGGGCACAGTGG - Intergenic
1102271161 12:111536561-111536583 GGCTGATTTCCTGGGCATAGTGG - Intronic
1105064484 12:133184767-133184789 GGCCAATTAGCTGGGCATGGTGG - Intronic
1113000451 13:105629977-105629999 GGTCCATTTGCAGTTTATAGGGG - Intergenic
1113319591 13:109220872-109220894 GGCCCATTGGGCGATCATAGGGG + Intergenic
1117670645 14:58102388-58102410 GTCCCATTTGCAGGTTCTAGGGG - Intronic
1118333688 14:64833898-64833920 GGCCCATTTGGAGGTCAAGGTGG + Intronic
1128277637 15:66366892-66366914 AGCCCATTGGCTGGGCATGGTGG + Intronic
1129751260 15:78066159-78066181 GTCCCCTTTGCTGATCATGGTGG - Intronic
1129951691 15:79597512-79597534 GGGCCATTTGCTGGTGCCAGTGG + Intergenic
1131198741 15:90378786-90378808 GTCCCATATGCTGGGCATACCGG + Intergenic
1132931491 16:2461153-2461175 GGGCCATTTGCTGGTCCCTGAGG - Exonic
1135641565 16:24124036-24124058 GGCACATTTGCTGTTCCTATGGG + Intronic
1140586800 16:76302420-76302442 GGGCCATTTTCGGGTCCTAGAGG + Intronic
1141060994 16:80869713-80869735 TGCTCATTTCCTGATCATAGGGG - Intergenic
1142050427 16:87954604-87954626 GGCCCCTTTGCTGGCCGTGGGGG + Intronic
1142796115 17:2308666-2308688 GGCCAATTAGCTGGGCATGGTGG + Intronic
1143579762 17:7818651-7818673 GGCCCAGCTGCTGGGCATTGTGG + Exonic
1143875334 17:9986743-9986765 GGCCCATTTGGAGGTTAGAGGGG - Intronic
1144087049 17:11819568-11819590 GGCCAATTAGCTGGGCATGGTGG - Intronic
1145924801 17:28638450-28638472 GGCCCAATTGATGGCCACAGTGG - Intronic
1147046438 17:37755596-37755618 GGCCCAGTGGCTGGTCAGAGCGG + Intergenic
1148628614 17:49089582-49089604 TCTCTATTTGCTGGTCATAGGGG - Intergenic
1152625548 17:81386565-81386587 GGCGCATGTGCTTGTCAGAGAGG - Intergenic
1152963317 18:94023-94045 GGCCTATCTGCTAGTCAGAGTGG - Intergenic
1154225983 18:12504661-12504683 GGCCCATGTTCTTGTCAAAGGGG + Intronic
1155582385 18:27324369-27324391 TGCCCATTTCCTGGTCCTACAGG - Intergenic
1163647570 19:18498593-18498615 AGCCCAGCTGCTGGTCATTGGGG - Intronic
1165576395 19:36823161-36823183 GGCCCATTTTTTGGTCTTAAGGG + Intronic
1167574535 19:50311837-50311859 GGCCCTATTGCTGGGCACAGTGG - Intergenic
1168469600 19:56629582-56629604 GGCCCATTCCCAGTTCATAGAGG - Intergenic
936394190 2:112107957-112107979 GGGCCATGTACTGGTGATAGGGG - Intronic
937415242 2:121709576-121709598 GGCTGATTTGCTGGGCATAGTGG - Intergenic
937646514 2:124271389-124271411 AGCCCATTTCATGGTCAGAGAGG + Intronic
937883312 2:126884219-126884241 GGCCTCTTTGCTGGTCAAGGAGG - Intergenic
1170543970 20:17417435-17417457 AACCCATTTACTGGTCAAAGTGG - Intronic
1172415645 20:34764967-34764989 AGCCAATTAGCTGGGCATAGTGG + Intronic
1175037926 20:56017791-56017813 GCCCCATCTTCTGGTCATGGTGG + Intergenic
1176869137 21:14072670-14072692 AGCCCCTTTGCTGGGCATGGGGG - Intergenic
1177387328 21:20425232-20425254 GCTCCATTTGCAGGGCATAGCGG + Intergenic
1179404248 21:41112191-41112213 GGGGCATTTGCCGGGCATAGTGG + Intergenic
1179493009 21:41753611-41753633 GAAGCATTTGCTGGTCAGAGTGG - Intronic
1183812277 22:40267010-40267032 TGCCGATTTACTGGTCATTGGGG - Exonic
949869107 3:8571676-8571698 GCCCCACTGGCTGGTAATAGAGG - Intergenic
951656397 3:25013730-25013752 GGACCATGTGCTGGTCAGAAAGG + Intergenic
955126186 3:56115083-56115105 AGCCAATTTACTGGTCTTAGTGG - Intronic
956217110 3:66860043-66860065 GGCCTGTTTGCTTCTCATAGAGG + Intergenic
958483331 3:94673376-94673398 TGCACATTTGCTTTTCATAGAGG + Intergenic
960333427 3:116390575-116390597 GGACCATTAGCTGGGCATGGTGG + Intronic
960919234 3:122729700-122729722 GGCACATTGGCTGGTCACGGTGG - Exonic
965351731 3:167620505-167620527 TGCCCAGTTAATGGTCATAGTGG + Intronic
967327908 3:188260463-188260485 AGCCCACTTACTGGTCATACTGG - Intronic
970189219 4:13495074-13495096 GGCCCTTATGCTGGGCATGGTGG - Intergenic
974988631 4:69059292-69059314 GGCCCATCGGTTGGTCAAAGAGG + Intronic
981167097 4:141573630-141573652 AGACCATTGGCTGGGCATAGTGG + Intergenic
984547761 4:181127853-181127875 GCTCCATTTGCTGGTGATTGAGG + Intergenic
996007992 5:118446580-118446602 TGCTCATTTGCTCATCATAGTGG - Intergenic
996105960 5:119503633-119503655 GGCTCATTTGTTGGCTATAGTGG + Intronic
1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG + Intronic
1002785888 6:399762-399784 GGCACTTTTGCTGCTCAGAGGGG + Intronic
1003156776 6:3603540-3603562 GGCCCCTTTGCTGGGGATGGTGG + Intergenic
1003414792 6:5898137-5898159 GGCCCAGGTCCTGCTCATAGTGG - Intergenic
1003840836 6:10117694-10117716 GGCCAATATGCTGGTCTCAGGGG + Intronic
1006602179 6:35233390-35233412 GGCCCAGGTGCTGGGCACAGAGG + Intronic
1007139513 6:39556574-39556596 GGCCCCTGTTCTGGTCAGAGGGG - Intronic
1013058155 6:106605126-106605148 GGCACTTTTGTTGGACATAGGGG - Intronic
1018026902 6:159813928-159813950 GCTCCATTTGCTGGTGACAGGGG - Intronic
1018430961 6:163722519-163722541 GGGACATTTGCAGGTCATAGGGG + Intergenic
1019576657 7:1740840-1740862 GGCCCCTTGGCTGGGCATGGTGG + Intronic
1023819942 7:43975048-43975070 GGCTCAGTGGCTGGTCAGAGGGG + Intergenic
1025115157 7:56251504-56251526 CTGCCATTTGTTGGTCATAGAGG + Intergenic
1032820594 7:135520880-135520902 GGGCCATTTGCTAGTCTAAGGGG + Intergenic
1036911747 8:12763342-12763364 GGCCTATTTCCTGTTTATAGAGG + Intergenic
1037595916 8:20353912-20353934 GGGCCATTTGCTAGACAGAGGGG + Intergenic
1043966117 8:86478170-86478192 TGCCCATTTGCTGGACACGGTGG - Intronic
1053368433 9:37540817-37540839 AGCCCATTAGCTGCTCATGGAGG - Intronic
1056946731 9:91003961-91003983 GGCCCTGATGCTGGTCATGGTGG + Intergenic
1059424767 9:114214014-114214036 CGCCGATTTGCTGGCCATGGTGG - Intronic
1062734773 9:138129680-138129702 GGCCTATCTGCTAGTCAGAGTGG + Intergenic
1197591981 X:128420182-128420204 GGCCCATTGGATGATGATAGGGG - Intergenic
1198794296 X:140379210-140379232 GGCCCAGTGGCTGGGCATGGTGG + Intergenic