ID: 910622098

View in Genome Browser
Species Human (GRCh38)
Location 1:89267083-89267105
Sequence CAGGATCTTCAACCCTGTCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910622096_910622098 12 Left 910622096 1:89267048-89267070 CCACACTAAGTCTGGGAAGAAGC 0: 1
1: 1
2: 1
3: 10
4: 124
Right 910622098 1:89267083-89267105 CAGGATCTTCAACCCTGTCAAGG 0: 1
1: 0
2: 1
3: 11
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910622098 Original CRISPR CAGGATCTTCAACCCTGTCA AGG Exonic
901421275 1:9152857-9152879 CTAGATCTTAAACCCTGTGATGG - Intergenic
902107084 1:14046884-14046906 CAGAATTTTCATCCCTATCAGGG + Intergenic
905661748 1:39732599-39732621 CAGGATTTTCAACCTTGCCCAGG + Intronic
906239750 1:44235637-44235659 CAGGCCCTGAAACCCTGTCATGG + Intronic
906481806 1:46204022-46204044 CAGGAACTTAAACCCTTTCCCGG - Intronic
907082141 1:51633642-51633664 CAGGGTCTTGCACTCTGTCACGG + Intronic
908123752 1:61009733-61009755 CAGGATATTCCACCATGCCAAGG + Intronic
908857720 1:68448693-68448715 CAGGATGCTCAACCCTGAAATGG + Exonic
909744242 1:79073594-79073616 CAGCATCCCCAACTCTGTCATGG - Intergenic
910031747 1:82734258-82734280 CAGGCACTTCAACCCTTTAATGG + Intergenic
910622098 1:89267083-89267105 CAGGATCTTCAACCCTGTCAAGG + Exonic
912525565 1:110280369-110280391 CAGAGTCTTCAACCTTGGCAGGG - Intronic
912730417 1:112097534-112097556 AAGGATGTTCTTCCCTGTCAAGG - Intergenic
913097288 1:115530756-115530778 GAGATTCTACAACCCTGTCAGGG + Intergenic
913687728 1:121248926-121248948 CAAGATCCTTAACCCAGTCAGGG - Intronic
914039586 1:144036574-144036596 CAAGATCCTTAACCCAGTCAGGG - Intergenic
914149870 1:145031363-145031385 CAAGATCCTTAACCCAGTCAGGG + Intronic
916163664 1:161944630-161944652 CAGGATCAGCAAGCATGTCAAGG + Intronic
918314363 1:183310736-183310758 CAGGATTTTCAACCCTGGCACGG - Intronic
920475053 1:206267448-206267470 CAAGATCCTTAACCCAGTCAGGG - Intronic
921274525 1:213505715-213505737 CAGGCTCTTGAACCCTGCCCAGG - Intergenic
924710750 1:246528148-246528170 CAGGAGCTTCAACGGTGGCAGGG + Intergenic
1064915513 10:20452580-20452602 CAGTATTTTCCACACTGTCAGGG - Intergenic
1068049545 10:51931957-51931979 CAGGATTTTCAAACATATCAAGG - Intronic
1078993846 11:16676526-16676548 CAGAATCTTCAACCTTCTCTGGG + Intronic
1079095268 11:17505883-17505905 CACCATCTCCAAACCTGTCATGG - Exonic
1081413341 11:42785532-42785554 CAGGGTTTTTAGCCCTGTCAGGG + Intergenic
1085484920 11:76854774-76854796 GAGGCTCTTCAACCCTGTCTGGG + Intergenic
1085489696 11:76903817-76903839 GAGGATCTTCTTCCCTTTCAAGG + Intronic
1087246024 11:95838251-95838273 AAGCATATTCATCCCTGTCATGG + Intronic
1091951499 12:4596603-4596625 CAGGATCTTCAGCTCCATCAGGG - Exonic
1093370405 12:18357921-18357943 CAGGATTTTCTTCCTTGTCAAGG + Intronic
1094321476 12:29188796-29188818 CAGACTCTTCAAAACTGTCAGGG - Intronic
1103792127 12:123479249-123479271 AAGTATCTTCCATCCTGTCAGGG - Intronic
1105951037 13:25229719-25229741 CAGGAGATTTAACCCTTTCAGGG - Intergenic
1107720053 13:43238855-43238877 CTGGATCTTCAACTGTGTGATGG - Intronic
1109139763 13:58699962-58699984 CATGTTCTTCATCCATGTCATGG - Intergenic
1109620385 13:64896754-64896776 AATAATCCTCAACCCTGTCAAGG + Intergenic
1113117320 13:106887069-106887091 GAAGATACTCAACCCTGTCAGGG + Intergenic
1117650252 14:57897246-57897268 AAGGAGCTTTAACCCTATCAGGG - Intronic
1126382062 15:48059033-48059055 TGGGATCTTCATCACTGTCAGGG + Intergenic
1127118601 15:55751459-55751481 CAGGAGCTTGAACCTTGTCCTGG + Intergenic
1128909990 15:71504930-71504952 CATGCTCTTCAAAACTGTCAAGG - Intronic
1129743951 15:78005088-78005110 AAGGATCTTCTCCCATGTCAGGG - Intronic
1131482226 15:92792071-92792093 CAGGAACCACAACCCTGGCAGGG + Intronic
1137605806 16:49786213-49786235 CAGGCTCTCCATCACTGTCAGGG + Intronic
1138117504 16:54372273-54372295 CAGCAGATTCAATCCTGTCAGGG - Intergenic
1146892634 17:36515867-36515889 CCTGAACTCCAACCCTGTCATGG - Exonic
1148456314 17:47813322-47813344 CAAGCCCTTCAACCCTGTCCTGG - Exonic
1160065611 18:75571396-75571418 CTGTATCTTCATCCCTGTGATGG - Intergenic
1161450387 19:4342591-4342613 CCGGACTTTCAACCCTGCCAGGG + Intronic
1162582435 19:11539382-11539404 CAGGATCTCCCACACTTTCACGG - Intronic
1162828766 19:13270924-13270946 CATGATCTACAAGCCTGCCAGGG + Intronic
1164843665 19:31413565-31413587 CTGGATCATCTGCCCTGTCAGGG + Intergenic
925633772 2:5922600-5922622 CAGCATCTTCAATCCTGCCACGG + Intergenic
932746819 2:74340741-74340763 CAGGGTCCTCAACCCCGTCAGGG - Intronic
934769605 2:96899470-96899492 CAGGGTCTTGCAGCCTGTCAGGG - Intronic
936977286 2:118232625-118232647 CAGGGTCTCCCACCCTGTAAAGG + Intergenic
937598310 2:123696892-123696914 CATGATCTTCCAGCCTTTCATGG - Intergenic
937719995 2:125082886-125082908 CATGTTCTTTAAGCCTGTCATGG - Intergenic
939246469 2:139630928-139630950 CAAGATCTGCCACCATGTCAGGG + Intergenic
939532088 2:143375647-143375669 CAGGATCTTCAACTTTCACAGGG - Intronic
941784137 2:169479633-169479655 AGGGATCTTCAACCCTGTAGAGG + Intronic
942040552 2:172057757-172057779 CAGTATCTTCAACTGTGACATGG + Intronic
942230413 2:173856208-173856230 CAGGGCCTCTAACCCTGTCAAGG + Intergenic
945265406 2:207886396-207886418 CAGTGTTTTCAACACTGTCAAGG + Intronic
947765322 2:232633929-232633951 CAGGGTCTTCAACCCCTACACGG + Exonic
948460016 2:238124472-238124494 CTGGAACTTCAGCCCTGACATGG - Intronic
1172151745 20:32795760-32795782 CTGGCTCATCCACCCTGTCAGGG + Intronic
1172306333 20:33883303-33883325 CAGGATTTCCAACCCTGGCCAGG - Intergenic
1174283588 20:49456623-49456645 CAGGATCTGCATCCCTAACAAGG - Intronic
1174603407 20:51742868-51742890 CAGTATTTACAGCCCTGTCAGGG - Intronic
1176865807 21:14054611-14054633 CAGGAGTTTGAACCCGGTCAAGG - Intergenic
1181643864 22:24219861-24219883 CAGGATCTGGACCCCTGGCAGGG - Exonic
1181737853 22:24895835-24895857 CAGGAGCTTAAACCCAGTCTGGG + Intronic
1181762995 22:25070633-25070655 CAGGATCTTCATTCCTGTTCAGG - Intronic
1182459098 22:30471726-30471748 CAGTAACATCAACCCTGTCCCGG - Intronic
951072699 3:18351218-18351240 CAGGATTTTCAAACCTGTAAAGG - Intronic
951391848 3:22114667-22114689 CAGCATCTTCACCCCTGACCTGG - Intronic
953880232 3:46687571-46687593 CAGGCACTCCCACCCTGTCAGGG + Intronic
962703560 3:138022046-138022068 CAGGAGCTCAAACACTGTCAGGG + Intronic
963261995 3:143202190-143202212 CAGGCTCTACATCCCAGTCAGGG + Intergenic
967622852 3:191654239-191654261 CAGGATCTTCAACTTTGGTAGGG - Intergenic
967771756 3:193341543-193341565 CAGGATCTGCTGCCCTGTCCAGG + Intronic
969712912 4:8854320-8854342 CAGGCTCTTCATCCCATTCAGGG - Intronic
969763438 4:9209135-9209157 CAGGATCTTCATTCCTGGTAAGG + Intergenic
969863425 4:10055575-10055597 CAGGATATTCAACCTTGCCAGGG - Intergenic
972177047 4:36420457-36420479 CTGGATGCTCATCCCTGTCAGGG - Intergenic
973196492 4:47448686-47448708 CACACTCTTCAACACTGTCAAGG + Intergenic
975250481 4:72173029-72173051 CAGGGTCTTCAACTCTGACTTGG - Intergenic
978711894 4:111792784-111792806 CTGGATTAACAACCCTGTCAAGG - Intergenic
980243115 4:130202355-130202377 CAGGATCTTCAGGCCAGGCACGG + Intergenic
980652233 4:135733090-135733112 TACGATCTTCTGCCCTGTCAAGG - Intergenic
986807615 5:11323568-11323590 CAGGATCCTGTACCCTGTCATGG - Intronic
991504366 5:67308715-67308737 CAGGATCTTCTTCCCTGTTGGGG + Intergenic
992002072 5:72445441-72445463 CTGTATCTTTAATCCTGTCAGGG + Intronic
992066989 5:73118411-73118433 CAGGATATTCAAGTCTGTCATGG + Intergenic
994810410 5:104511108-104511130 CAGGATCTTCTGCACAGTCATGG + Intergenic
999623912 5:153500159-153500181 CAGGATCTTCAAACTAGTCAGGG - Intronic
1007489133 6:42204384-42204406 CAAGAGATTTAACCCTGTCAGGG - Intergenic
1007816981 6:44531588-44531610 CAGCGTCTTCATCCCTGCCAGGG + Intergenic
1011985404 6:93437323-93437345 AAGGAACTTCAACCTTGTCATGG - Intergenic
1013005056 6:106064816-106064838 CAGAATCTGCAAGCCTCTCAAGG - Intergenic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1023367122 7:39475258-39475280 CAGGATCTTCAAACACTTCAGGG - Intronic
1025713777 7:63934576-63934598 CATCATCCTCAACCCTGTTATGG - Intergenic
1028848053 7:95505077-95505099 CAGTCTCTTCAGCCCTGTCCTGG + Intronic
1030651839 7:112124480-112124502 AAGGATATTCCACCCAGTCAAGG + Intronic
1032280628 7:130497844-130497866 CAGGAGCTTCAGCCCTATCTTGG - Intronic
1032420373 7:131774553-131774575 CACCATCTTCAACCCTTTCCTGG + Intergenic
1035330793 7:158096173-158096195 GAGTCTCTCCAACCCTGTCATGG + Intronic
1037833692 8:22203917-22203939 CAGGAGCTTCACCCCTGTCCTGG - Intronic
1039760162 8:40565893-40565915 CAGGACCTTCACCACTGTGAAGG + Intronic
1043001677 8:74767533-74767555 CAGGACTTTCAACCATCTCATGG - Intronic
1046324192 8:112619339-112619361 CTGGAGCTTAAATCCTGTCAAGG - Intronic
1048836346 8:138522492-138522514 CAGGGTCTTGAACCTTGTAAAGG - Intergenic
1048890418 8:138941978-138942000 CAGAAGCCTCAAGCCTGTCAAGG + Intergenic
1049413886 8:142486408-142486430 CTGGGTCATCAACCCGGTCATGG - Intronic
1058611173 9:106777231-106777253 CAGGACCTTCAAGTCTGGCAAGG - Intergenic
1060794779 9:126506334-126506356 CAGCCTCTTCAACTCTGACAAGG - Exonic
1203777127 EBV:79796-79818 CAGGATCTTCACCCGTGAGATGG + Intergenic
1203783212 EBV:112633-112655 CAGCATGTTCAACGCGGTCAAGG - Intergenic
1186810350 X:13181969-13181991 CAGCTTCCTCAACACTGTCAGGG - Intergenic
1190439667 X:50464622-50464644 AAGGATCTTCAACCTCGCCAAGG - Intronic
1195349744 X:103985021-103985043 CAGGATCTCCAACTGTGACATGG + Intergenic
1195352176 X:104006123-104006145 CAGGATCTCCAACCGTGACATGG - Intergenic
1195357699 X:104053818-104053840 CAGGATCTCCAACTGTGACATGG - Intergenic
1198496812 X:137201533-137201555 CAGACTCTTCAAAACTGTCAGGG + Intergenic