ID: 910622682

View in Genome Browser
Species Human (GRCh38)
Location 1:89273655-89273677
Sequence TCGCGCTGGCCCTCAAGCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 1, 2: 5, 3: 10, 4: 60}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910622672_910622682 16 Left 910622672 1:89273616-89273638 CCGAGTGCAGGTCCCTCAGAGCC 0: 1
1: 0
2: 4
3: 65
4: 435
Right 910622682 1:89273655-89273677 TCGCGCTGGCCCTCAAGCACCGG 0: 1
1: 1
2: 5
3: 10
4: 60
910622673_910622682 4 Left 910622673 1:89273628-89273650 CCCTCAGAGCCCAAGCCCACCCA 0: 1
1: 0
2: 5
3: 97
4: 595
Right 910622682 1:89273655-89273677 TCGCGCTGGCCCTCAAGCACCGG 0: 1
1: 1
2: 5
3: 10
4: 60
910622674_910622682 3 Left 910622674 1:89273629-89273651 CCTCAGAGCCCAAGCCCACCCAG 0: 1
1: 0
2: 65
3: 367
4: 1955
Right 910622682 1:89273655-89273677 TCGCGCTGGCCCTCAAGCACCGG 0: 1
1: 1
2: 5
3: 10
4: 60
910622675_910622682 -5 Left 910622675 1:89273637-89273659 CCCAAGCCCACCCAGAACTCGCG 0: 1
1: 29
2: 202
3: 403
4: 975
Right 910622682 1:89273655-89273677 TCGCGCTGGCCCTCAAGCACCGG 0: 1
1: 1
2: 5
3: 10
4: 60
910622676_910622682 -6 Left 910622676 1:89273638-89273660 CCAAGCCCACCCAGAACTCGCGC 0: 1
1: 34
2: 218
3: 451
4: 1012
Right 910622682 1:89273655-89273677 TCGCGCTGGCCCTCAAGCACCGG 0: 1
1: 1
2: 5
3: 10
4: 60
910622669_910622682 28 Left 910622669 1:89273604-89273626 CCTGGGGCCGCTCCGAGTGCAGG 0: 2
1: 2
2: 11
3: 48
4: 217
Right 910622682 1:89273655-89273677 TCGCGCTGGCCCTCAAGCACCGG 0: 1
1: 1
2: 5
3: 10
4: 60
910622671_910622682 21 Left 910622671 1:89273611-89273633 CCGCTCCGAGTGCAGGTCCCTCA 0: 1
1: 0
2: 1
3: 48
4: 259
Right 910622682 1:89273655-89273677 TCGCGCTGGCCCTCAAGCACCGG 0: 1
1: 1
2: 5
3: 10
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910622682 Original CRISPR TCGCGCTGGCCCTCAAGCAC CGG Intergenic
910622682 1:89273655-89273677 TCGCGCTGGCCCTCAAGCACCGG + Intergenic
910625592 1:89303148-89303170 TCACGCTGGTCCCCGAGCACCGG + Intergenic
915497896 1:156294280-156294302 TGGAGGTGGCCCTTAAGCACAGG - Intronic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
924329511 1:242927901-242927923 TAGAGCTGGCCCTCAGGCAAGGG + Intergenic
924671277 1:246128637-246128659 TGGGGCTGGCCCTCAAGCCCAGG + Intronic
1066489652 10:35882596-35882618 TCTCCCTGCCCCTCAGGCACAGG - Intergenic
1077392646 11:2307184-2307206 CCCTGCTGGCCCCCAAGCACAGG - Intronic
1077764561 11:5144445-5144467 TCGCGCTGGTCAGCAAGCGCTGG - Intergenic
1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG + Intergenic
1090223153 11:125048661-125048683 TCCCCCTGGCCCCCAAACACAGG + Intergenic
1095444989 12:42274032-42274054 TCCAGCTGGCCCGCAAGCACTGG + Intronic
1095587382 12:43863930-43863952 TCTAGCTGGCCCGCAAGCGCCGG - Intronic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1102238033 12:111306964-111306986 CCGCGCTGGCCTCCAAGGACAGG + Exonic
1109562850 13:64075866-64075888 TCGCTCTGATCCCCAAGCACAGG + Intergenic
1112264639 13:97912286-97912308 TTGTGCTGGCCCACATGCACAGG + Intergenic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1116653745 14:47626588-47626610 TCGCGCTGGCCCGCAAGCGCCGG - Intronic
1129161489 15:73750522-73750544 TTGAGCTGGGCCTCAAGCAGTGG + Intronic
1129190408 15:73934130-73934152 TCCAGCTGGCCCACAAGCAGGGG - Intronic
1130564080 15:84980376-84980398 TCGCGCTGGGACTGCAGCACAGG - Intergenic
1131912560 15:97224278-97224300 TCGCGCTGGCCCGCCAGCGCCGG - Intergenic
1136146617 16:28320125-28320147 TGGCGCTGGACTTCATGCACGGG + Exonic
1137547126 16:49411889-49411911 TCCCCCTGGCCCCCAAGCTCAGG + Intergenic
1146119395 17:30177484-30177506 TAGGGCTGGCCCTGAAACACTGG + Intronic
1148991222 17:51668803-51668825 TCGCGCTGGCCCACGAGTGCAGG - Intronic
1151714615 17:75825090-75825112 TGGGGCTGGCCCTGCAGCACTGG - Exonic
1166118431 19:40669920-40669942 TGGTGCTGGCGCTCCAGCACTGG + Exonic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
934526641 2:95056224-95056246 TCCCTCTGGCCCTGAAGCCCTGG + Intergenic
940784630 2:157968200-157968222 TCGCGCTGGCCCACAAGCACCGG + Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
943106185 2:183546975-183546997 TCGTGCTGGCCTGCAAGCCCAGG + Intergenic
945183059 2:207111406-207111428 TGGCTCTGCTCCTCAAGCACAGG + Intronic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
947466788 2:230357914-230357936 TCGCGGAGGCCCTCAAGGAATGG - Exonic
1171813629 20:29764098-29764120 CCGCGCTGGCACTAAAGCCCCGG + Intergenic
1172126428 20:32627529-32627551 TCGCCCTGGCCCCCCAGCCCTGG + Intergenic
1177318696 21:19493628-19493650 TCGCGCTGGCCGGCAAGCGCCGG - Intergenic
1185279947 22:49965746-49965768 TAGCTCTGGCCTTCTAGCACAGG + Intergenic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
954145319 3:48631554-48631576 TCCAGCTGGCCCTCAAATACAGG + Intronic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
962758219 3:138484680-138484702 TCCAGCTGGCCCGCAAGCACCGG - Intergenic
963778687 3:149465242-149465264 ACGGGCGGACCCTCAAGCACTGG - Intergenic
973144285 4:46805121-46805143 TCGCGCTGGCCTCCAAGCACCGG + Intronic
973764339 4:54149628-54149650 TCGCGCTGGCCGGCGAGCACGGG + Intronic
975298791 4:72765930-72765952 TCCTGCTGGCCTGCAAGCACCGG - Intergenic
975754795 4:77561919-77561941 TTGTGCTGGCCCACAAGCACTGG - Intronic
980827347 4:138088898-138088920 TCGTGCTGGCCTGCAAGCGCCGG + Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
983579264 4:169291690-169291712 TCTCTCTGGCCCTCAAGGAGTGG - Intergenic
984728631 4:183045108-183045130 TCGCACTGGTCCGCAAGCACGGG - Intergenic
985893933 5:2738394-2738416 TCTCCCTGGCTCTCAAGCAATGG - Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
988489160 5:31692293-31692315 TTGCGCTGGCCCGCAAGCACCGG + Intronic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1000609117 5:163355889-163355911 TCGCACTGGCCCACAAGCACCGG - Intergenic
1001638196 5:173227741-173227763 TCTTGCAGGCCCTCAAGAACTGG + Intergenic
1004906184 6:20239095-20239117 TCGCGCTGGCCCACAAGTACCGG - Intergenic
1018551359 6:165001912-165001934 TCGTGCTGGCCCGCGAGCGCTGG + Intergenic
1021510965 7:21432013-21432035 TAGCGCTGGCCTAGAAGCACTGG - Intronic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1035586960 8:783984-784006 TGGCGATGGCCCTCAAGCCTTGG - Intergenic
1036123850 8:6045346-6045368 TCGCACGGGCCCGCAAGCACCGG + Intergenic
1041914834 8:63128274-63128296 CCCCGCTGGGCCTCAGGCACTGG + Intergenic
1043224041 8:77700757-77700779 CTGCGCAGGCCCGCAAGCACTGG - Intergenic
1049336560 8:142089736-142089758 TGGGGCAGGCCCACAAGCACAGG + Intergenic
1059330422 9:113532052-113532074 TGGCCCTGGCCCAGAAGCACTGG - Intronic
1060925888 9:127454816-127454838 TCCCTCTGGGCCTCAAGCTCTGG + Intronic
1188881779 X:35499307-35499329 TCCCGCTGGCTCGCAAGCGCCGG - Intergenic
1193697717 X:84729595-84729617 TCGCACTAGCCCTCCAGCAATGG - Intergenic
1200955294 Y:8938368-8938390 TCATGCTGGCCCTCGAGCACTGG - Intergenic
1201226872 Y:11827022-11827044 TAGAGCTGGCCCTCAGGCAAGGG + Intergenic
1201468312 Y:14309318-14309340 TCATGCTGGCCTGCAAGCACCGG - Intergenic