ID: 910630217

View in Genome Browser
Species Human (GRCh38)
Location 1:89346227-89346249
Sequence GCCTTGCTCCAAAATCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910630217_910630221 17 Left 910630217 1:89346227-89346249 CCTCTGGGATTTTGGAGCAAGGC No data
Right 910630221 1:89346267-89346289 ATAACTACTCTCCTTCTGAGAGG No data
910630217_910630222 27 Left 910630217 1:89346227-89346249 CCTCTGGGATTTTGGAGCAAGGC No data
Right 910630222 1:89346277-89346299 TCCTTCTGAGAGGCAGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910630217 Original CRISPR GCCTTGCTCCAAAATCCCAG AGG (reversed) Intergenic
No off target data available for this crispr