ID: 910630219

View in Genome Browser
Species Human (GRCh38)
Location 1:89346250-89346272
Sequence AGTTATCTGCAAAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910630219_910630224 15 Left 910630219 1:89346250-89346272 CCTGCCATCTTTTGCAGATAACT No data
Right 910630224 1:89346288-89346310 GGCAGCTCTTGGCCTGTTACTGG 0: 9
1: 173
2: 187
3: 147
4: 210
910630219_910630222 4 Left 910630219 1:89346250-89346272 CCTGCCATCTTTTGCAGATAACT No data
Right 910630222 1:89346277-89346299 TCCTTCTGAGAGGCAGCTCTTGG No data
910630219_910630226 22 Left 910630219 1:89346250-89346272 CCTGCCATCTTTTGCAGATAACT No data
Right 910630226 1:89346295-89346317 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232
910630219_910630227 25 Left 910630219 1:89346250-89346272 CCTGCCATCTTTTGCAGATAACT No data
Right 910630227 1:89346298-89346320 GGCCTGTTACTGGGCTTTGGTGG 0: 144
1: 161
2: 86
3: 68
4: 218
910630219_910630225 16 Left 910630219 1:89346250-89346272 CCTGCCATCTTTTGCAGATAACT No data
Right 910630225 1:89346289-89346311 GCAGCTCTTGGCCTGTTACTGGG No data
910630219_910630221 -6 Left 910630219 1:89346250-89346272 CCTGCCATCTTTTGCAGATAACT No data
Right 910630221 1:89346267-89346289 ATAACTACTCTCCTTCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910630219 Original CRISPR AGTTATCTGCAAAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr