ID: 910630225

View in Genome Browser
Species Human (GRCh38)
Location 1:89346289-89346311
Sequence GCAGCTCTTGGCCTGTTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910630220_910630225 12 Left 910630220 1:89346254-89346276 CCATCTTTTGCAGATAACTACTC 0: 5
1: 185
2: 202
3: 119
4: 262
Right 910630225 1:89346289-89346311 GCAGCTCTTGGCCTGTTACTGGG No data
910630219_910630225 16 Left 910630219 1:89346250-89346272 CCTGCCATCTTTTGCAGATAACT No data
Right 910630225 1:89346289-89346311 GCAGCTCTTGGCCTGTTACTGGG No data
910630218_910630225 17 Left 910630218 1:89346249-89346271 CCCTGCCATCTTTTGCAGATAAC 0: 6
1: 192
2: 177
3: 141
4: 252
Right 910630225 1:89346289-89346311 GCAGCTCTTGGCCTGTTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910630225 Original CRISPR GCAGCTCTTGGCCTGTTACT GGG Intergenic
No off target data available for this crispr