ID: 910631558

View in Genome Browser
Species Human (GRCh38)
Location 1:89360683-89360705
Sequence TAGCAACAGCAACAACAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910631558_910631559 10 Left 910631558 1:89360683-89360705 CCTGTTTGTTGTTGCTGTTGCTA No data
Right 910631559 1:89360716-89360738 TTTTGTAACAGCATGTAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910631558 Original CRISPR TAGCAACAGCAACAACAAAC AGG (reversed) Intergenic
No off target data available for this crispr