ID: 910636091

View in Genome Browser
Species Human (GRCh38)
Location 1:89409629-89409651
Sequence TTCCTATGTTGAGGGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910636091_910636094 8 Left 910636091 1:89409629-89409651 CCAGCACTCCCTCAACATAGGAA No data
Right 910636094 1:89409660-89409682 ATAAATTTTCCTTTGTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910636091 Original CRISPR TTCCTATGTTGAGGGAGTGC TGG (reversed) Intergenic
No off target data available for this crispr