ID: 910637085

View in Genome Browser
Species Human (GRCh38)
Location 1:89420610-89420632
Sequence TGTATGGAAAAGACCTATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910637081_910637085 24 Left 910637081 1:89420563-89420585 CCTGAGAAAATTGACCTATTTTA No data
Right 910637085 1:89420610-89420632 TGTATGGAAAAGACCTATGTTGG No data
910637083_910637085 0 Left 910637083 1:89420587-89420609 CCTCAGCATTCTAAGCTTTAAAA No data
Right 910637085 1:89420610-89420632 TGTATGGAAAAGACCTATGTTGG No data
910637082_910637085 10 Left 910637082 1:89420577-89420599 CCTATTTTAGCCTCAGCATTCTA No data
Right 910637085 1:89420610-89420632 TGTATGGAAAAGACCTATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910637085 Original CRISPR TGTATGGAAAAGACCTATGT TGG Intergenic
No off target data available for this crispr