ID: 910638992

View in Genome Browser
Species Human (GRCh38)
Location 1:89439976-89439998
Sequence CATTATCTGCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910638986_910638992 25 Left 910638986 1:89439928-89439950 CCACCAAAGTCCAGTAACAGGCC 0: 8
1: 152
2: 160
3: 95
4: 183
Right 910638992 1:89439976-89439998 CATTATCTGCAGAAGATGGCAGG No data
910638990_910638992 4 Left 910638990 1:89439949-89439971 CCAAGAGTTGTCTCTCAAAAGGA 0: 17
1: 200
2: 191
3: 170
4: 310
Right 910638992 1:89439976-89439998 CATTATCTGCAGAAGATGGCAGG No data
910638988_910638992 15 Left 910638988 1:89439938-89439960 CCAGTAACAGGCCAAGAGTTGTC 0: 17
1: 171
2: 183
3: 131
4: 176
Right 910638992 1:89439976-89439998 CATTATCTGCAGAAGATGGCAGG No data
910638987_910638992 22 Left 910638987 1:89439931-89439953 CCAAAGTCCAGTAACAGGCCAAG 0: 8
1: 181
2: 166
3: 110
4: 213
Right 910638992 1:89439976-89439998 CATTATCTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910638992 Original CRISPR CATTATCTGCAGAAGATGGC AGG Intergenic
No off target data available for this crispr