ID: 910639672

View in Genome Browser
Species Human (GRCh38)
Location 1:89446352-89446374
Sequence GACTATCTATGTTCACTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910639664_910639672 27 Left 910639664 1:89446302-89446324 CCAGAATAGCACTGAGTCTTGAC No data
Right 910639672 1:89446352-89446374 GACTATCTATGTTCACTTAAGGG No data
910639668_910639672 -2 Left 910639668 1:89446331-89446353 CCACTGTAACCACTACCTGGCGA No data
Right 910639672 1:89446352-89446374 GACTATCTATGTTCACTTAAGGG No data
910639666_910639672 5 Left 910639666 1:89446324-89446346 CCAAGGTCCACTGTAACCACTAC 0: 6
1: 35
2: 88
3: 166
4: 412
Right 910639672 1:89446352-89446374 GACTATCTATGTTCACTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910639672 Original CRISPR GACTATCTATGTTCACTTAA GGG Intergenic
No off target data available for this crispr