ID: 910640497

View in Genome Browser
Species Human (GRCh38)
Location 1:89456187-89456209
Sequence AGAGGAGCTAAAGTCCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910640497_910640502 8 Left 910640497 1:89456187-89456209 CCCTCAGGGACTTTAGCTCCTCT No data
Right 910640502 1:89456218-89456240 AAGCTGTGCTTGGGCAAAAGAGG No data
910640497_910640500 -2 Left 910640497 1:89456187-89456209 CCCTCAGGGACTTTAGCTCCTCT No data
Right 910640500 1:89456208-89456230 CTGAATTTATAAGCTGTGCTTGG No data
910640497_910640501 -1 Left 910640497 1:89456187-89456209 CCCTCAGGGACTTTAGCTCCTCT No data
Right 910640501 1:89456209-89456231 TGAATTTATAAGCTGTGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910640497 Original CRISPR AGAGGAGCTAAAGTCCCTGA GGG (reversed) Intergenic
No off target data available for this crispr