ID: 910640498

View in Genome Browser
Species Human (GRCh38)
Location 1:89456188-89456210
Sequence CAGAGGAGCTAAAGTCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910640498_910640500 -3 Left 910640498 1:89456188-89456210 CCTCAGGGACTTTAGCTCCTCTG No data
Right 910640500 1:89456208-89456230 CTGAATTTATAAGCTGTGCTTGG No data
910640498_910640501 -2 Left 910640498 1:89456188-89456210 CCTCAGGGACTTTAGCTCCTCTG No data
Right 910640501 1:89456209-89456231 TGAATTTATAAGCTGTGCTTGGG No data
910640498_910640502 7 Left 910640498 1:89456188-89456210 CCTCAGGGACTTTAGCTCCTCTG No data
Right 910640502 1:89456218-89456240 AAGCTGTGCTTGGGCAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910640498 Original CRISPR CAGAGGAGCTAAAGTCCCTG AGG (reversed) Intergenic
No off target data available for this crispr