ID: 910640499

View in Genome Browser
Species Human (GRCh38)
Location 1:89456205-89456227
Sequence AGCACAGCTTATAAATTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910640499_910640502 -10 Left 910640499 1:89456205-89456227 CCTCTGAATTTATAAGCTGTGCT No data
Right 910640502 1:89456218-89456240 AAGCTGTGCTTGGGCAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910640499 Original CRISPR AGCACAGCTTATAAATTCAG AGG (reversed) Intergenic
No off target data available for this crispr