ID: 910640502

View in Genome Browser
Species Human (GRCh38)
Location 1:89456218-89456240
Sequence AAGCTGTGCTTGGGCAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910640498_910640502 7 Left 910640498 1:89456188-89456210 CCTCAGGGACTTTAGCTCCTCTG No data
Right 910640502 1:89456218-89456240 AAGCTGTGCTTGGGCAAAAGAGG No data
910640499_910640502 -10 Left 910640499 1:89456205-89456227 CCTCTGAATTTATAAGCTGTGCT No data
Right 910640502 1:89456218-89456240 AAGCTGTGCTTGGGCAAAAGAGG No data
910640497_910640502 8 Left 910640497 1:89456187-89456209 CCCTCAGGGACTTTAGCTCCTCT No data
Right 910640502 1:89456218-89456240 AAGCTGTGCTTGGGCAAAAGAGG No data
910640496_910640502 9 Left 910640496 1:89456186-89456208 CCCCTCAGGGACTTTAGCTCCTC No data
Right 910640502 1:89456218-89456240 AAGCTGTGCTTGGGCAAAAGAGG No data
910640493_910640502 25 Left 910640493 1:89456170-89456192 CCATTGGTTGAGAGTTCCCCTCA No data
Right 910640502 1:89456218-89456240 AAGCTGTGCTTGGGCAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910640502 Original CRISPR AAGCTGTGCTTGGGCAAAAG AGG Intergenic
No off target data available for this crispr