ID: 910646306

View in Genome Browser
Species Human (GRCh38)
Location 1:89519108-89519130
Sequence CAGCTGAACCACTGGGACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910646303_910646306 8 Left 910646303 1:89519077-89519099 CCTCATCAACAACAATGTGCTCA No data
Right 910646306 1:89519108-89519130 CAGCTGAACCACTGGGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910646306 Original CRISPR CAGCTGAACCACTGGGACTC TGG Intergenic
No off target data available for this crispr