ID: 910647035

View in Genome Browser
Species Human (GRCh38)
Location 1:89525060-89525082
Sequence AGCCGCGCCGACCGAGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910647030_910647035 -5 Left 910647030 1:89525042-89525064 CCCGGTTCCAGGAGGGCGAGCCG 0: 1
1: 0
2: 1
3: 10
4: 114
Right 910647035 1:89525060-89525082 AGCCGCGCCGACCGAGGTGGTGG 0: 1
1: 0
2: 0
3: 6
4: 128
910647031_910647035 -6 Left 910647031 1:89525043-89525065 CCGGTTCCAGGAGGGCGAGCCGC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 910647035 1:89525060-89525082 AGCCGCGCCGACCGAGGTGGTGG 0: 1
1: 0
2: 0
3: 6
4: 128
910647029_910647035 -4 Left 910647029 1:89525041-89525063 CCCCGGTTCCAGGAGGGCGAGCC 0: 1
1: 0
2: 0
3: 7
4: 99
Right 910647035 1:89525060-89525082 AGCCGCGCCGACCGAGGTGGTGG 0: 1
1: 0
2: 0
3: 6
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910647035 Original CRISPR AGCCGCGCCGACCGAGGTGG TGG Intronic
902389048 1:16092185-16092207 AGACCCACCCACCGAGGTGGAGG + Intergenic
902456415 1:16536656-16536678 AAGCGCGCCCACCGGGGTGGAGG - Intergenic
903100458 1:21024320-21024342 AGCCGCCCCGACCGTGAGGGAGG + Intronic
903519477 1:23935883-23935905 AGCCGCCCCGTCCGAGAGGGAGG + Intergenic
903525038 1:23987132-23987154 AGCCGCCCCGTCCGAGAGGGAGG - Intergenic
907982493 1:59497818-59497840 AGCAGCGCCGACAGAGTTGCAGG - Intronic
910647035 1:89525060-89525082 AGCCGCGCCGACCGAGGTGGTGG + Intronic
910981120 1:92961167-92961189 AGCCGCGAGGGCCGCGGTGGGGG + Intronic
914428693 1:147600445-147600467 AGCCGCGAAGAGCGGGGTGGAGG + Intronic
914824949 1:151133367-151133389 CGCCGCGCCCACCGACGTCGGGG - Exonic
919640980 1:200042906-200042928 AGCCGCGCCGCGCGTCGTGGCGG + Intronic
922307473 1:224356902-224356924 AGCGGCGGCGACGGAGGAGGAGG + Exonic
923372606 1:233328114-233328136 GGCCGAGCCGCCCGAGGAGGTGG - Exonic
1065637497 10:27745821-27745843 AGCCGAGACGACGGCGGTGGCGG - Exonic
1067026564 10:42847688-42847710 AGCCGCCCCGACCGGGAGGGAGG + Intergenic
1067339852 10:45392060-45392082 AGCCGCCCCGTCCGAGAGGGAGG + Intronic
1070895829 10:79982320-79982342 AGCAGCGCCGCCCGAGGCGCTGG - Intronic
1074465783 10:113679989-113680011 AGAGGCGCCGGCCGAGGTGGGGG - Intronic
1076687844 10:132206082-132206104 AGCAGCGCCCACCTGGGTGGCGG - Intergenic
1077485719 11:2837600-2837622 AACCGGGCAGACAGAGGTGGGGG + Intronic
1083281671 11:61630497-61630519 AGCCGTGGAGACGGAGGTGGAGG + Intergenic
1084165456 11:67373067-67373089 AGCGGCGCGGCCCGAGGTGTCGG + Intronic
1084275144 11:68047557-68047579 GGCCGCGCAGAACGAGGTGAGGG + Exonic
1087948778 11:104194979-104195001 AGCCGCCCCGACCGGGAGGGAGG + Intergenic
1088462069 11:110092934-110092956 AGGAGCGCGGAGCGAGGTGGCGG + Intergenic
1089421031 11:118331726-118331748 AGCCGCGCCGTCCGGGAGGGAGG - Intergenic
1091263513 11:134252962-134252984 ACCCGCGCAGAGCGAGATGGAGG + Exonic
1094103322 12:26785277-26785299 AGCCGCCCCGTCCGAGAGGGAGG + Intronic
1098883779 12:75941934-75941956 AGCCGCCCCGACCGGGAGGGAGG + Intergenic
1101317614 12:103643806-103643828 AGCCGCCCCGACCGGGAGGGAGG + Intronic
1105745723 13:23375522-23375544 AGCCGCGGCGGCCGAGGAGCAGG + Intronic
1107468172 13:40667265-40667287 AGCCGCGGCGCCGGGGGTGGGGG - Intergenic
1107809861 13:44189783-44189805 AGCCGCTCTGACTGATGTGGGGG - Intergenic
1113194087 13:107783040-107783062 AGCCGCCCCGACCGGGAGGGAGG + Intronic
1113597831 13:111547138-111547160 AGCTGCGACGACTCAGGTGGAGG - Intergenic
1114470381 14:22957126-22957148 GGCCGCGACGAAGGAGGTGGAGG + Exonic
1116928606 14:50668040-50668062 GGCGGCGCCGGCGGAGGTGGCGG - Exonic
1122630039 14:103103530-103103552 AGGAGCGCCCACGGAGGTGGGGG + Intronic
1131184802 15:90265368-90265390 AGCCCTGCCCACCGAGGTGGCGG + Intronic
1133188533 16:4116626-4116648 AGCGGCGCCGCCCGGGGCGGGGG - Intergenic
1137554206 16:49460531-49460553 AGCCGCACCAACCCAGCTGGAGG + Intergenic
1139390852 16:66605499-66605521 AGCCCCACCGGCCGGGGTGGGGG - Intronic
1141694743 16:85614054-85614076 AGCCGCTCCGCCGGGGGTGGGGG - Intronic
1142172467 16:88630071-88630093 AGGCGCGGCAACCGAGGGGGGGG - Intronic
1142705029 17:1689344-1689366 AGCCGCCCCGTCCGGGATGGAGG - Intergenic
1144547994 17:16215440-16215462 CGCCGCGCCGAACGAGGTCCCGG - Exonic
1145370813 17:22304786-22304808 AGCGGCGCAGTCCAAGGTGGCGG - Intergenic
1148206730 17:45784250-45784272 AGCGGCGCGGACCGTGGGGGAGG + Intergenic
1152468088 17:80476811-80476833 AGCAGCGCCGGCCCAGGCGGGGG - Intronic
1154278355 18:12980256-12980278 AGCCGCCCCGACCGGGAGGGAGG - Intronic
1157629281 18:49080221-49080243 AGCCGCCCCGTCCGAGAGGGAGG - Intronic
1162751764 19:12833863-12833885 AGCCGCGGGGACCGCGGCGGCGG - Intronic
1162930720 19:13956247-13956269 AGCCGAGCCCACCCAGGTGAGGG + Exonic
1163893733 19:20039308-20039330 GGCCGCGCATCCCGAGGTGGGGG - Intronic
1165742487 19:38212051-38212073 AGCCGAGCCGGCCTAGGTGAGGG + Exonic
1167622774 19:50568368-50568390 TGCCGCACCGTCCGAGGCGGGGG - Intergenic
1167638456 19:50667989-50668011 AGCCGAGCCTACGGGGGTGGCGG - Exonic
926215339 2:10902640-10902662 AGCCGCCCCGACCGGGAGGGAGG - Intergenic
928558005 2:32447617-32447639 AGCCGCGCCGTCCGGGAGGGAGG - Intronic
931681196 2:64751122-64751144 AGCCGCGCCGCCATAGGTCGAGG - Intergenic
932807496 2:74796134-74796156 AGCCGCCCCGACCGGGAGGGAGG - Intergenic
934248573 2:90326029-90326051 AGCCGCGTCGCCCGGGGTCGGGG + Intergenic
938368780 2:130756114-130756136 GGGCGCGCCGGCCGCGGTGGGGG - Intronic
942450941 2:176107703-176107725 GGCCGCGGCGGCCGAGGAGGCGG + Exonic
942630337 2:177946077-177946099 AGCCGCCCCGTCCGGGATGGAGG + Intronic
1168757253 20:325981-326003 ACCCGGGCCGGCCGAGGAGGGGG + Exonic
1170578779 20:17682546-17682568 CGCCCCGCCCACCGAGGGGGGGG + Intergenic
1170623124 20:18010665-18010687 AGCCGCCCCGACCGGGAGGGAGG - Intronic
1170999442 20:21397467-21397489 AGCTGCCGCGGCCGAGGTGGCGG - Exonic
1171523355 20:25792214-25792236 AGCAGCGCAGTCCGAGGCGGCGG + Intronic
1171553471 20:26063669-26063691 AGCAGCGCAGTCCGAGGCGGCGG - Intergenic
1171957039 20:31470566-31470588 AGCCGCCCCGTCCGGGATGGAGG - Intronic
1174582190 20:51579831-51579853 AGCCATGCCGATGGAGGTGGTGG - Intergenic
1176301920 21:5102571-5102593 TGCAGCGCCGACTGAGGTGAGGG - Intergenic
1178075741 21:29011966-29011988 AGCCGCGCCGTCCGGGAGGGAGG + Intronic
1179539625 21:42075742-42075764 AGCCGCTGTGACCGAGGAGGAGG - Intronic
1179855110 21:44159329-44159351 TGCAGCGCCGACTGAGGTGAGGG + Intergenic
1180534542 22:16386773-16386795 AGCCGCGGCGGCGGGGGTGGGGG - Intergenic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
1181024196 22:20118137-20118159 AGATGCGCCGACCCAGGCGGCGG + Intronic
1182331154 22:29552552-29552574 AGCCGCCCCGTCCGGGGGGGAGG + Intronic
1183360942 22:37383205-37383227 AGCCCAGCCGAGGGAGGTGGAGG - Intronic
952942144 3:38453669-38453691 GGGCGCGCGGACGGAGGTGGCGG - Intergenic
953871374 3:46630087-46630109 AGCTGCGCCGCCTGAGGCGGAGG + Intergenic
956270425 3:67444085-67444107 AGCCGCGCCGTCCGGGAGGGAGG + Intronic
960862276 3:122165131-122165153 AGCCGCCCCGTCTGAGGTGAGGG + Intergenic
961734671 3:128993921-128993943 GGCTGCGGCGGCCGAGGTGGGGG + Intronic
967055342 3:185825107-185825129 GGCCGGGCCGGCCGCGGTGGGGG - Intergenic
968258190 3:197297998-197298020 GGCCGCGGCGAGCGAGGAGGCGG - Intronic
968636669 4:1684434-1684456 CGCCGCGCCGACGGAGGGGGCGG + Intergenic
968667025 4:1828008-1828030 AGCCGCCCCGTCCGGGTTGGGGG - Intronic
969912118 4:10456939-10456961 CGCCGGGGCGACCGAGGCGGGGG - Intronic
970472672 4:16393391-16393413 AGCCGCCCCGACCGGGAGGGAGG - Intergenic
972939801 4:44182145-44182167 AGCCGCCCCGTCCGAGAGGGAGG + Intronic
973672833 4:53237783-53237805 AGCCGCCCCGTCCGGGATGGAGG - Intronic
973675121 4:53255854-53255876 AGCCGCCCCGTCCGGGATGGAGG - Intronic
978123687 4:105110592-105110614 AGCCGCCCCGTCCGAGAGGGTGG + Intergenic
981366664 4:143912138-143912160 GGCGGCGCCGGCGGAGGTGGCGG - Intergenic
982615918 4:157637144-157637166 AGCCGCGCCGTCCGGGAGGGAGG - Intergenic
984533655 4:180945287-180945309 AGCCGCCCCGTCCGGGATGGAGG + Intergenic
985899424 5:2777104-2777126 AGCCGCCCGGGCCGAGGTGCAGG - Intergenic
989575085 5:42980727-42980749 AGCCGCCCCGTCCGAGAGGGAGG + Intergenic
992469613 5:77042646-77042668 AGCCGCCCCGTCCGGGATGGAGG - Intronic
995942277 5:117599795-117599817 AGCCGCCCCGACCGGGAGGGAGG - Intergenic
996069869 5:119122051-119122073 AGCCGCCCCGACCGGGAGGGAGG - Intronic
1000159352 5:158583060-158583082 AGCCGCCCCGACCGGGAGGGAGG + Intergenic
1004414859 6:15415607-15415629 AGCCGCCCCGACCGGGAGGGAGG - Intronic
1006141333 6:31931905-31931927 AGCCGCGCCGTCCGGGAGGGAGG - Intronic
1006346269 6:33485699-33485721 AGCCGCCCCGTCCGGGGGGGGGG - Intergenic
1006785063 6:36660874-36660896 GGCCACGCCCACCGAGGGGGAGG - Intergenic
1007901936 6:45421473-45421495 AGTCGCTCAGACAGAGGTGGGGG + Intronic
1009484076 6:64198140-64198162 AGCCGGGCCGGCCGTGGTGGCGG - Intronic
1013793627 6:113860225-113860247 AGCGGCGCCGGGCGAGGAGGCGG + Exonic
1017843970 6:158240759-158240781 AGCCGTGCCGACCGGGAGGGAGG - Intronic
1017851334 6:158308643-158308665 AGCCGCCCCGTCCGAGAGGGAGG - Intronic
1020831805 7:13102975-13102997 AGCCGCCCCGACCGGGAGGGAGG + Intergenic
1026968518 7:74454516-74454538 AGTCGCGCTGCCCGCGGTGGCGG + Intronic
1029525743 7:101092600-101092622 AGCCGCGCCGTCCGGGAGGGAGG + Intergenic
1034234152 7:149554720-149554742 AGCCGCGCCGTCCGGGAGGGAGG + Intergenic
1036778403 8:11629115-11629137 AGCTGCGCAGGCCCAGGTGGAGG + Intergenic
1048472115 8:134712916-134712938 TCCCGTGCCGACCGAGGGGGCGG + Exonic
1049726298 8:144148043-144148065 CGGCGCCCCGGCCGAGGTGGCGG + Intronic
1049788443 8:144462384-144462406 AGCCGAGGCGGCCGAGGCGGCGG - Intronic
1051430574 9:16977384-16977406 AGCCGCCCCGTCCGAGAGGGAGG - Intergenic
1052492760 9:29189071-29189093 AGCCGCCCCGTCCGGGATGGAGG - Intergenic
1053255836 9:36615357-36615379 AGCCGTGCCGACCGGGAGGGAGG - Intronic
1057630451 9:96715630-96715652 AGCCGCCCCGTCCGAGGGGGAGG - Intergenic
1058053321 9:100427353-100427375 AGCCGCGGCGACCGGGGGAGGGG - Intronic
1058835389 9:108855251-108855273 AGCCGCGCCGACTACGCTGGGGG - Exonic
1060208964 9:121699033-121699055 AGCCGCGCCGACCGCGGCCGAGG - Intronic
1060283395 9:122228574-122228596 AGCCGGGCCGAGCAGGGTGGCGG - Intronic
1190337071 X:49269214-49269236 AGCCGAGCCAATGGAGGTGGAGG - Intergenic
1190337236 X:49269940-49269962 CGCCGCCTCGACCGAGGTGCGGG - Exonic
1197692886 X:129522574-129522596 AACCCCGCCTGCCGAGGTGGGGG - Intronic
1198767089 X:140091328-140091350 GGCGGCGGCGACCGAGGCGGCGG + Intergenic