ID: 910648157

View in Genome Browser
Species Human (GRCh38)
Location 1:89535609-89535631
Sequence TACATTCTTAAAATGGATGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 375}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910648157 Original CRISPR TACATTCTTAAAATGGATGA CGG (reversed) Intronic
900362601 1:2297067-2297089 CACATTCTTCAAGTGGAAGACGG - Intronic
901766858 1:11506282-11506304 GACATTCTTAAAACTGATTATGG - Intronic
902463419 1:16597747-16597769 TACAATTTTAACATGGATAAAGG + Intronic
903158098 1:21462954-21462976 TACAATTTTAACATGGATAAAGG - Intronic
903169437 1:21542978-21543000 TACATTTTTAAAATAGAGGTGGG - Intronic
904125347 1:28234577-28234599 CACATTCATTAGATGGATGAAGG + Intergenic
904525947 1:31134009-31134031 TACATTTTGAAAATCAATGATGG - Intergenic
904781033 1:32948309-32948331 TACATTATCAAGATGAATGATGG - Exonic
905833079 1:41090145-41090167 TACACTCTTAAAATTTATGGAGG + Intronic
905856440 1:41317682-41317704 TACACTCTTACAATGGAAGCAGG + Intergenic
905918551 1:41703102-41703124 TCCATTCTGTAAATAGATGAAGG + Intronic
906491982 1:46275647-46275669 TAGATGCTTGAAATGGTTGAAGG - Intronic
907820861 1:57967015-57967037 TAAATTTTTTAAATGAATGAAGG + Intronic
908143760 1:61215942-61215964 TAAATTCTTGAAATGCTTGATGG + Intronic
908199480 1:61779687-61779709 TACATTCTTAAAAATTATTAAGG - Intronic
909052439 1:70782895-70782917 TATTTTCTTAAGATGGGTGATGG - Intergenic
909221864 1:72974146-72974168 CACATTCTTAAACTGAAAGAAGG - Intergenic
909981440 1:82106405-82106427 TATATTCTCAAAATTGATGAAGG - Intergenic
910648157 1:89535609-89535631 TACATTCTTAAAATGGATGACGG - Intronic
911021035 1:93387891-93387913 TGTATTTTTTAAATGGATGATGG + Intergenic
912146298 1:106798297-106798319 GACATTCATAAAATTGATGGAGG + Intergenic
912738766 1:112174330-112174352 TACAGTCTGAAAATTGCTGATGG - Intergenic
913502529 1:119484199-119484221 TACAGTTATAAAAAGGATGAGGG + Intergenic
913609837 1:120500341-120500363 TTCATTCTTTAAATGGAGAAGGG - Intergenic
914203973 1:145510790-145510812 TTCATTCTTTAAATGGAGAAGGG + Intergenic
914483097 1:148083944-148083966 TTCATTCTTTAAATGGAGAAGGG + Intergenic
914581354 1:149021900-149021922 TTCATTCTTTAAATGGAGAAGGG + Intronic
915116106 1:153600848-153600870 TACATATTTTAAATGGATGATGG - Intergenic
916300135 1:163264627-163264649 TAAATTATTAAAGTGGAAGAAGG - Intronic
916873678 1:168945471-168945493 TATATTCATAAAATGCTTGAAGG - Intergenic
919156196 1:193768900-193768922 TACATTATTAAAATAGAATATGG - Intergenic
919246099 1:194986729-194986751 TACATTCTCAAAATGTATTCAGG - Intergenic
920668453 1:207983901-207983923 TACAGTCTTAAAAATTATGAAGG + Intergenic
921298456 1:213726779-213726801 AACATTATTAAAATGAATGTAGG + Intergenic
922300714 1:224297513-224297535 GACATTCTGGAAATGGATGGGGG + Intronic
922400390 1:225248084-225248106 TAATATCTTCAAATGGATGAAGG + Intronic
922560574 1:226566309-226566331 TACATTTTTAAAAGGCATAAAGG + Intronic
923100481 1:230810600-230810622 AACATACTGAAAATGGATGATGG - Intergenic
923293416 1:232569510-232569532 AACATTTTAAAAATCGATGAAGG + Intergenic
923710399 1:236384258-236384280 TATATTCCTACAATGTATGAGGG + Intronic
924061526 1:240180156-240180178 TGCATTCTTGAAGAGGATGATGG + Intronic
924668766 1:246101958-246101980 TAGATTGTTAAAATGGATAATGG - Intronic
924748868 1:246865966-246865988 TGCATTCTTTATATGGATTATGG - Intronic
1064939119 10:20713116-20713138 TCCATTCAAAAAATGAATGATGG + Intergenic
1065765016 10:29020912-29020934 TAAATATTTCAAATGGATGATGG + Intergenic
1066321604 10:34308463-34308485 TACATTCTTAAACTGCTTGTGGG + Intronic
1069142275 10:64840692-64840714 TACATTATTGAAATTGATGCGGG - Intergenic
1069290335 10:66771407-66771429 TACAGTTTTCAAATGAATGATGG + Intronic
1069688932 10:70337008-70337030 TCCTTCCATAAAATGGATGAAGG + Intronic
1070197252 10:74169587-74169609 TACAATCTTTAAATGGAAGCTGG - Intronic
1071102257 10:82052576-82052598 TTCATTCTTAAAACAGATCAGGG - Intronic
1071150173 10:82624868-82624890 TCCTTTCTTAAAATTAATGAGGG - Intronic
1071153254 10:82660919-82660941 TATGTTCTAAAAATGGAAGAGGG - Intronic
1071325370 10:84510585-84510607 TACATTCTAAAAATGTCTGAGGG + Intronic
1071987341 10:91065399-91065421 CACATTTCTAAAATGGATGGAGG - Intergenic
1072497798 10:95979809-95979831 TACAATCTGGAAATGGATGGTGG + Intronic
1072889600 10:99310918-99310940 TCTGTTTTTAAAATGGATGATGG - Intergenic
1074033102 10:109708918-109708940 AACTTTCTTAAATTGTATGAAGG - Intergenic
1074409350 10:113211871-113211893 TACACTTTGAAAATGGAGGAAGG + Intergenic
1074842196 10:117366138-117366160 TACCTTCTTAAAATGTATATAGG - Intronic
1076932311 10:133540258-133540280 TACATTTGTAAAATGCATCAAGG - Intronic
1079599766 11:22296568-22296590 TAGATTTTTAAAATAGGTGAAGG + Intergenic
1079758561 11:24298820-24298842 TACATTGTAAAAACCGATGATGG - Intergenic
1080059884 11:27946089-27946111 TTCATTTTTAAAATGGGTGCTGG + Intergenic
1081412297 11:42774062-42774084 CTCATTTTTAAAATGGATAATGG + Intergenic
1081829131 11:46091568-46091590 TACATTCTTAAAATTAATATTGG - Intronic
1082956896 11:58879731-58879753 AACATTCTGGAAATGGATGGGGG + Intronic
1083189310 11:61038074-61038096 TATATTTTTAAAATGGATGATGG - Intergenic
1085867699 11:80314499-80314521 TGTATTTTTAAAACGGATGATGG + Intergenic
1086029095 11:82332098-82332120 TACATTTTTTAAATGGCTAATGG - Intergenic
1086485615 11:87298313-87298335 TACAATCATAAAATGGCTTAAGG + Intronic
1086827442 11:91517228-91517250 TACATGCTTACAATGGATAAAGG + Intergenic
1087187185 11:95212734-95212756 TACAATCTGGAAATGAATGAAGG - Intronic
1088941127 11:114457488-114457510 ATCATTCTGAAAATGGATCATGG - Intergenic
1088948486 11:114539622-114539644 TAAATTCTTAAGATGGGAGATGG + Intronic
1089009418 11:115120510-115120532 AACATTGTTACAATGAATGAGGG - Intergenic
1089544044 11:119208815-119208837 CACATACTTTAAATAGATGAAGG - Intronic
1089664464 11:120009380-120009402 GACATACTTGACATGGATGAAGG - Intergenic
1089737828 11:120562174-120562196 TTCCTTATTAAAATGGATAAAGG - Intronic
1089915943 11:122156470-122156492 TACATTTTTAAAAAGGAAGGGGG - Intergenic
1090626323 11:128611927-128611949 TACTGTCTTAAAATGGGTGACGG + Intergenic
1092995504 12:13946355-13946377 TACATTTTAAAAATGGATGGTGG - Intronic
1094749265 12:33386597-33386619 TACAGTCTCAGAATGAATGATGG - Intronic
1094751566 12:33415894-33415916 AACATTCTAAAAAGGGATTAAGG - Intronic
1094867478 12:34554277-34554299 TACATTCTGCAAATGGATATAGG - Intergenic
1096218896 12:49815354-49815376 TACATGATTAAATGGGATGAAGG - Intronic
1096392849 12:51242676-51242698 TCCATTCATAAAATGAATGTGGG + Exonic
1097322780 12:58244691-58244713 TACCTTCCTGAAATGCATGAAGG + Intergenic
1097591555 12:61581595-61581617 TACATTCTTCAAAGGGAGAAAGG + Intergenic
1097916001 12:65021046-65021068 AACATTTTTAAAAAGAATGATGG - Intergenic
1098298300 12:69027203-69027225 GACATTCTGGAAATGGATAATGG + Intergenic
1099698617 12:86055752-86055774 TACCATCCTAAAATGGGTGAGGG + Intronic
1100746368 12:97650683-97650705 TACATTCTTAAAAATTATTAAGG + Intergenic
1101219365 12:102620979-102621001 TACATTTTTAAAATAGAAAATGG - Intergenic
1101292794 12:103388543-103388565 TTTATTCTTAAGATGAATGATGG + Intronic
1101584879 12:106076907-106076929 AACATTCTAGAGATGGATGATGG + Intronic
1102456799 12:113076065-113076087 CACATTTTTAAATAGGATGATGG + Intronic
1103314161 12:120038957-120038979 TAGATTCTTAAAATACATGAAGG + Intronic
1104201155 12:126590676-126590698 ACTATTCTTAAAATAGATGAAGG + Intergenic
1104912554 12:132246223-132246245 CACATTTTTAAAATGGAAGCTGG - Intronic
1105897997 13:24733681-24733703 TCTATTCTTAAAATGGGTGAAGG + Intergenic
1105911105 13:24868527-24868549 TACATTATAAAAATTCATGATGG - Intronic
1106543380 13:30710107-30710129 TGTATTCTTAAAATAGAAGAGGG + Intergenic
1107503775 13:41009912-41009934 TATATTCTTAAAATGTATTGAGG + Intronic
1108062467 13:46547099-46547121 TACATTGTGAACATGGAAGAAGG - Intergenic
1109082705 13:57926222-57926244 TACATTATTAAAATTGAACATGG - Intergenic
1109151502 13:58853707-58853729 TATATTCTTGACATGCATGACGG - Intergenic
1109596428 13:64560960-64560982 TAAATTTTTTAAATGTATGACGG + Intergenic
1109739343 13:66531668-66531690 TAAATACTTAAAATGCAAGAGGG + Intronic
1110099390 13:71577471-71577493 TCCATTCTTAGAAAGGAAGAAGG + Intronic
1110099749 13:71583330-71583352 TACCTTCTTAATATTGATGTTGG - Intronic
1110116777 13:71827373-71827395 TATATTCTTCAAATTAATGAAGG - Intronic
1110826901 13:79981484-79981506 TATTTTTTTAAAATGGAGGAAGG - Intergenic
1111387342 13:87544193-87544215 TACATTTTTAAAATGAGGGAAGG - Intergenic
1113163721 13:107413613-107413635 AACATTATTAAAATGCATGAAGG - Intronic
1113224681 13:108146603-108146625 TACTTTTTTAAAAAGGAAGATGG + Intergenic
1114653880 14:24304310-24304332 CATATTCTCTAAATGGATGATGG - Intronic
1115445160 14:33481438-33481460 TAAATTCTGTAAATGGATAAGGG - Intronic
1115913475 14:38283060-38283082 TAAATACATTAAATGGATGATGG - Intergenic
1116964565 14:51000702-51000724 TACATTCTGGAGCTGGATGATGG - Exonic
1118389158 14:65281765-65281787 TATACTCTTAAAATGTATGTAGG - Intergenic
1118513844 14:66505996-66506018 TGCATTCATAAAAGGGGTGATGG - Intergenic
1119189827 14:72673543-72673565 TTCATTCTTAAAATGAATTCAGG - Intronic
1119289476 14:73483687-73483709 TTTATTTTTAAAATGGATGATGG + Intronic
1119926278 14:78497374-78497396 TACATTCTTTAAGAGGATCATGG - Intronic
1119949161 14:78726888-78726910 AAGATTCTGAAGATGGATGATGG - Intronic
1120314793 14:82877833-82877855 CACATTCTTATATTGGAAGAAGG + Intergenic
1120403154 14:84058730-84058752 TACATTTTATAAATGCATGAAGG - Intergenic
1124807320 15:32898764-32898786 GACATTCATAAGTTGGATGATGG - Intronic
1127240818 15:57112092-57112114 CACCTTCTTAAGACGGATGAGGG - Intronic
1130933032 15:88445084-88445106 TACATTGTTAAATTGTATTATGG + Intergenic
1131545281 15:93310613-93310635 TACTTTCTCTAAATGGATGCAGG + Intergenic
1131949416 15:97664928-97664950 TATTTTCTTAAACTGGCTGAGGG - Intergenic
1131985283 15:98037380-98037402 TAGATTTTTAAAGTGGATGATGG - Intergenic
1131985629 15:98040784-98040806 TACATTATTAAAATTAAGGATGG - Intergenic
1138499937 16:57434730-57434752 TACATCATTAATATGAATGAAGG + Intronic
1140774342 16:78236315-78236337 TACATACTTACAAAGGATGGTGG + Intronic
1140781598 16:78301934-78301956 AACATTCTAAAATTAGATGAGGG + Intronic
1141322307 16:83022996-83023018 TACCATCTAAAAATGGATAAGGG - Intronic
1144042400 17:11424122-11424144 AACAGTCTTTAAATAGATGATGG + Intronic
1144140855 17:12346717-12346739 TATATTCTTAATATTGTTGATGG + Intergenic
1147755587 17:42765229-42765251 TATATTAATAAAATGCATGAAGG - Intergenic
1147755896 17:42767562-42767584 TATATTCATGAAATGCATGAAGG + Intergenic
1148378947 17:47178051-47178073 TACATGCTTACAATGGGGGAAGG + Intronic
1149215498 17:54349064-54349086 TCAATTCTTAAAATGGATAAAGG + Intergenic
1149722613 17:58861511-58861533 GACTTTCTTTAAATGGGTGACGG + Intronic
1151414104 17:73950398-73950420 TTCATGCTAAAAATGGAAGAAGG + Intergenic
1151647835 17:75445717-75445739 TTCATTTTTAAAATGCATGCTGG + Intronic
1153012515 18:551920-551942 AACATTCTGAAGATGGCTGATGG + Intergenic
1153557042 18:6325683-6325705 TTCATTCTTAAGCTGGATGGTGG + Intronic
1153827959 18:8894555-8894577 ATCATTCTTAAATTGGCTGATGG + Intergenic
1155419048 18:25633916-25633938 TACATTTTTAATATGTAAGAAGG + Intergenic
1156659105 18:39325778-39325800 TACATTCTTGAAATTGAAGAGGG + Intergenic
1156884178 18:42114844-42114866 TACATGATTAAAATGGATATGGG + Intergenic
1158047865 18:53177851-53177873 TACACTCTTAATATGACTGATGG - Intronic
1158243529 18:55404804-55404826 TACATATATAAAATGGATGGTGG + Intronic
1158348357 18:56538885-56538907 TATTTTCTTAAATTGGATTATGG - Intergenic
1158797055 18:60859073-60859095 CAAACTCTTAAAAAGGATGATGG - Intergenic
1159804806 18:72943384-72943406 GGCATTCTTAAAAAGAATGATGG + Intergenic
1160889164 19:1368233-1368255 TACTTTCTAAAAATGGATGAAGG + Intronic
1161774405 19:6251261-6251283 TCCATTCTTAAAAAGGTTGGGGG + Intronic
1161879207 19:6936103-6936125 AACATATTTAAAATGGATAAGGG - Intronic
1162272482 19:9627827-9627849 AATTTACTTAAAATGGATGAAGG - Intronic
1202679081 1_KI270711v1_random:35194-35216 TACAATTTTAACATGGATAAAGG + Intergenic
925049982 2:805863-805885 TCCATTCTCACAAGGGATGATGG + Intergenic
925234771 2:2268123-2268145 TACATGCATCAAATGGATGTGGG - Intronic
925760385 2:7179033-7179055 TACATTCTTCAAATGTATTGAGG - Intergenic
925862731 2:8195770-8195792 TACATTCATAAAATGCAAAATGG - Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
927768870 2:25840456-25840478 AACGTTCTAAAGATGGATGATGG - Intronic
928139491 2:28715986-28716008 TACACTCTTAAAATGAATGATGG + Intergenic
928759844 2:34569091-34569113 TACATTTTTATACTGAATGAAGG - Intergenic
930207260 2:48600394-48600416 TACATTCTTTAAACAGAAGAGGG + Intronic
930543198 2:52733543-52733565 CACACTCTTAAAATTGTTGATGG + Intergenic
932222991 2:70014951-70014973 TTCATTTTTAAAATGGGTAAAGG + Intergenic
933322875 2:80798798-80798820 TACATTTATAAAATAAATGATGG + Intergenic
933386794 2:81621175-81621197 AACATTCTTAAAATACAAGATGG + Intergenic
935711922 2:105906771-105906793 TACAATCTTAAAAAGTATTACGG - Intergenic
936043397 2:109167195-109167217 CATATTTTTAAAAAGGATGATGG + Intronic
936145063 2:109975446-109975468 CACATGCTTCAGATGGATGAGGG - Intergenic
936181751 2:110273408-110273430 CACATGCTTCAGATGGATGAGGG - Intergenic
936199621 2:110396021-110396043 CACATGCTTCAGATGGATGAGGG + Intergenic
936230815 2:110698271-110698293 CACATGCTTCAGATGGATGAGGG + Intergenic
936512883 2:113162556-113162578 TACGTACTTAAAAACGATGAAGG - Intronic
938185009 2:129223683-129223705 AAAGTTCTTAAAATGGATGGTGG + Intergenic
939601214 2:144192840-144192862 TACATTCTTCAAATTGATACCGG - Intronic
939615217 2:144354770-144354792 TACATTCTTAAAAGGTATTGAGG + Intergenic
939760884 2:146177485-146177507 TGCATTCCTATAATGTATGATGG + Intergenic
939951908 2:148485430-148485452 TAAAATCTAAAAATAGATGAAGG + Intronic
940537445 2:154963728-154963750 TACATTCTTATACTGCAGGAAGG - Intergenic
941169203 2:162117164-162117186 TCCATTCTGAAAGTGGTTGAGGG - Intergenic
941484459 2:166061920-166061942 TAAATTTTTAAAATGAATAAAGG - Intronic
942240735 2:173963293-173963315 TACATTATTAAAAAAAATGAGGG - Intronic
942473724 2:176291853-176291875 TGCATTCAGAAACTGGATGAAGG + Intronic
942561145 2:177220300-177220322 TAAATTCTGAAAAGGGATGGTGG + Intronic
943269706 2:185783408-185783430 TTCATTTTTAAAAAAGATGATGG - Intronic
944566209 2:200994112-200994134 TTTATTCCTCAAATGGATGATGG + Intronic
944696018 2:202201140-202201162 TCCATTCATAAAATGAATGTGGG - Intergenic
945155002 2:206829088-206829110 TACATACTTAAAAAGTAAGAGGG + Intergenic
945405738 2:209446628-209446650 TACATTATTAAAATAGGTGGAGG + Intronic
946508112 2:220323299-220323321 TGCCTTCTTCAAATGTATGAAGG - Intergenic
946720476 2:222600842-222600864 TCCATTCTTAATGTGGCTGATGG + Intronic
947220693 2:227789093-227789115 TATATTCTAGAAATGGAAGAGGG - Intergenic
948736669 2:240012550-240012572 AACATTCTAAAACTGGATTATGG + Intronic
948775720 2:240287922-240287944 CACATTGTTCAAATGGATGTGGG - Intergenic
1170054307 20:12182343-12182365 AACATTCTGAAAATGGATAGTGG + Intergenic
1170142511 20:13139033-13139055 TACATTTCTAAAATAGAGGAGGG + Intronic
1171470472 20:25366618-25366640 TAAAGTCTTGAAATGGAGGAGGG - Intronic
1171835441 20:30139372-30139394 TAGATTCTGAAAATGGATTCTGG + Intergenic
1172877248 20:38172193-38172215 AACATTCTAAAATTGGATGGTGG + Intergenic
1172994654 20:39061141-39061163 TACATGTTAAAAATAGATGAAGG - Intergenic
1173128271 20:40360842-40360864 TTCATTTTTTAAATGGATGATGG - Intergenic
1173574045 20:44098744-44098766 TCCATTCTTTATCTGGATGAAGG + Intergenic
1174979611 20:55378733-55378755 AACATTATTAAAATGGAAAAAGG + Intergenic
1176985053 21:15426155-15426177 TACATTCTTGAAGTAGATGCAGG + Intergenic
1177948456 21:27502464-27502486 TATTTTCTTAAAATGTATTAAGG - Intergenic
1178251829 21:31010471-31010493 TATATTCCTGAAATAGATGAAGG - Intergenic
1178791739 21:35706427-35706449 TAAATTTTTAAAATGCAAGATGG - Intronic
1179458738 21:41518777-41518799 AACATTCTGAAAATAGATGGCGG + Intronic
1181789590 22:25253975-25253997 TGCATACTTTAAATGGATGCAGG + Intergenic
1182901914 22:33905547-33905569 TGGATTTTTAAAATGAATGATGG - Intronic
1183887738 22:40898962-40898984 TAGTTTATTAAAATGGATGAAGG - Intronic
1184634461 22:45815816-45815838 TTCATCCTTTACATGGATGAAGG - Intronic
1184804603 22:46785466-46785488 TATATACTTTAAATGGGTGAAGG - Intronic
1184949512 22:47830616-47830638 TACATTCATTAGATGAATGATGG + Intergenic
949547876 3:5087963-5087985 TACCTTATTAGTATGGATGATGG + Intergenic
950681675 3:14589370-14589392 GACAGTCTAGAAATGGATGATGG + Intergenic
950803843 3:15579474-15579496 GACAGTATCAAAATGGATGAAGG + Intronic
953050737 3:39340588-39340610 TACTTTCCAAAAATGGATGCTGG + Intergenic
954051473 3:47982435-47982457 TATATTTTTAAACTAGATGATGG + Intronic
955730369 3:61979081-61979103 AATATTCTCCAAATGGATGATGG + Intronic
955980693 3:64523731-64523753 AAAATTCACAAAATGGATGATGG - Intronic
956078972 3:65537137-65537159 TAAATTCACAGAATGGATGAGGG - Intronic
956190982 3:66608247-66608269 TACATTCTTAAAATGAACAGGGG - Intergenic
956508243 3:69965695-69965717 TACATTTATAAAATGGAAAAGGG - Exonic
956701122 3:71959470-71959492 TTTATTTTTAAAATGGCTGAGGG - Intergenic
957318539 3:78599544-78599566 TACAATCTTTGAATGGGTGAGGG + Intronic
957348457 3:78992372-78992394 TACATTGTTAAGCTGGAGGAGGG + Intronic
958484717 3:94690197-94690219 TATATATTTAAAATGGAAGAAGG - Intergenic
958490018 3:94760793-94760815 TCCATTTTTAAAAATGATGAAGG - Intergenic
958635820 3:96744390-96744412 TACACTTTCAAAATGGAGGAAGG - Intergenic
959502301 3:107120324-107120346 TAAATTTTTTAAATGAATGAGGG + Intergenic
959610230 3:108285686-108285708 TCCAATCTGAAAATGGGTGAAGG + Intergenic
959704617 3:109328557-109328579 TACAGTCTTAACAGGGATGGTGG - Intronic
960460500 3:117928616-117928638 TACTTTTTTAAAATTGATGTAGG - Intergenic
960568537 3:119161977-119161999 TTTATTCTTTAAATGGAAGAAGG - Intronic
960723016 3:120643045-120643067 AACATGCTTAAAATGAATGTAGG + Intronic
961507448 3:127379435-127379457 AACATTGTTGAGATGGATGATGG + Intergenic
963184411 3:142397195-142397217 TACTTTCTAAAACAGGATGAAGG + Intronic
963365536 3:144329774-144329796 TACATTCCCACAATGTATGAAGG - Intergenic
963672010 3:148262635-148262657 AACAATCTTAAAAAGTATGAAGG + Intergenic
964036031 3:152197704-152197726 GAAAGTCTCAAAATGGATGAAGG - Intergenic
964197902 3:154085800-154085822 ATCATTCTTAAAATGGAAAAAGG - Intergenic
966052715 3:175640676-175640698 TATATTCTTCAAATGAATGATGG - Intronic
966124069 3:176554967-176554989 TACATTCTGAACCTGGATGTTGG - Intergenic
966506090 3:180703483-180703505 TACATTCATAAGATAGATGAAGG - Intronic
967342030 3:188408927-188408949 TATATTCTTATAAGGGATGCAGG - Intronic
968565201 4:1308734-1308756 TCCAATTTTAAAATGGGTGAAGG - Intronic
970653490 4:18203682-18203704 TTTTTTCTTAAAAGGGATGAAGG - Intergenic
971936253 4:33151922-33151944 TACTCTCTGAGAATGGATGAGGG - Intergenic
972012537 4:34202536-34202558 TACAATCTTAAATTGATTGAAGG - Intergenic
974441982 4:61930257-61930279 TACGTTTTTCAAATGGAGGAAGG + Intronic
974816387 4:67010241-67010263 AACATTTTTAAAATGTTTGATGG + Intergenic
975548193 4:75582283-75582305 AACATACTTGAAATGAATGAAGG + Intronic
976019646 4:80606086-80606108 TACATTTTTAAAATTAATAAAGG + Intronic
976777753 4:88724411-88724433 TACATTTTTAAAAAGGACAATGG + Intergenic
977710838 4:100123080-100123102 TACTTTTGTAAAATTGATGATGG - Intergenic
978237091 4:106472696-106472718 TAAATCCTTAAAAAAGATGAGGG - Intergenic
978595888 4:110376733-110376755 TAATTTCTTAAACTTGATGAGGG + Intronic
978968616 4:114774045-114774067 TACATTCATATAATGTATAAAGG + Intergenic
981258666 4:142693240-142693262 TACACTTTTAGAATGGCTGATGG + Intronic
981598796 4:146460467-146460489 TACATTCATACAATGGAATATGG + Intronic
981781211 4:148431893-148431915 TTCATTCTTAAAAAGTATGAAGG + Intronic
981986591 4:150864243-150864265 TACATTCTTAAAAAGTATTAAGG + Intronic
982135955 4:152274297-152274319 CACAGTCTTAACTTGGATGAAGG - Intergenic
982148701 4:152427684-152427706 TACACTCTTAAAAATTATGAAGG + Intronic
982356885 4:154480535-154480557 TACATTTTTCAAAAGCATGAAGG + Intronic
982465959 4:155732615-155732637 TAGATTCTTAAAATAAATAAGGG + Intergenic
982518850 4:156387428-156387450 CATAATCTTAAAATGAATGATGG - Intergenic
983193756 4:164782313-164782335 TTCATTTTTAAAATGTATGTAGG - Intergenic
983289061 4:165778286-165778308 TACAGTTTTAAAAAGCATGAAGG - Intergenic
983350450 4:166580972-166580994 TACATTATAAAGATTGATGAAGG - Intergenic
984144602 4:176045073-176045095 TACATTCTTAAAATTTATTGAGG - Intergenic
984999138 4:185467760-185467782 TACATTCTGAAAATGCAACAGGG + Intronic
985720927 5:1488586-1488608 TAAATTATTAAAATGCATTATGG + Intronic
987716803 5:21581895-21581917 TACATTTTAAAGATGGAAGAAGG + Intergenic
987870002 5:23603872-23603894 TACATACATAAAATAAATGAAGG - Intergenic
987902761 5:24034753-24034775 TACATTCTTGGGATGTATGATGG + Intronic
988281167 5:29148950-29148972 TACATTTTTAAAAAAGAAGAGGG - Intergenic
988444465 5:31270074-31270096 TACATTTTTAAAAAAGATAAAGG + Intronic
990192499 5:53275559-53275581 TACATTCTTAAACTTGAACAAGG - Intergenic
990531450 5:56677688-56677710 TACATTAAAAACATGGATGAAGG + Intergenic
990769029 5:59221864-59221886 TGCATTCTTAAATTGCATTAAGG - Intronic
992886391 5:81164469-81164491 TTCATTCTTAAACTTCATGAGGG - Intronic
992907835 5:81363975-81363997 TTCATTTTTAAAATGAAAGAAGG - Intronic
993177822 5:84510707-84510729 TACATTCTTAAAGTAGCTAAGGG - Intergenic
993337713 5:86682019-86682041 TATATTCTAAGCATGGATGAAGG + Intergenic
993567538 5:89493324-89493346 TTCATTCTTAAAATGATAGAAGG + Intergenic
994667843 5:102728255-102728277 TACATTTTGAAGATGGAGGAAGG + Intergenic
994940094 5:106312311-106312333 TAAATTTTTGGAATGGATGAGGG - Intergenic
995990966 5:118239335-118239357 TACATTGTTACAAAGTATGAAGG + Intergenic
996020399 5:118584997-118585019 TGCATTTTTAAAACAGATGATGG + Intergenic
997329624 5:133050725-133050747 TTCACTTTTAAAATGGCTGAAGG + Intergenic
997350594 5:133228357-133228379 TTCATTCCTTAAATGAATGAAGG - Intronic
998155796 5:139786421-139786443 TACATTTTTAAAATGAGTTAGGG + Intergenic
998423012 5:142004830-142004852 TACATTCTTATTAAAGATGAAGG - Intronic
998497925 5:142607004-142607026 TACCATCCTAAAATGTATGAAGG - Intronic
999654471 5:153798765-153798787 TACATTCTTGGAAGGGATGTTGG + Intronic
1000448661 5:161357237-161357259 CAAAGACTTAAAATGGATGAAGG + Intronic
1000931991 5:167262963-167262985 TGCATTCTCAACATGGTTGAAGG + Intergenic
1001500832 5:172232360-172232382 TAAATTCTTCAAATGTAGGAGGG + Intronic
1001840570 5:174873032-174873054 TCCCTCCTTAAAATGCATGAGGG - Intergenic
1003141527 6:3475594-3475616 AACATTTTTAGTATGGATGATGG + Intergenic
1003419329 6:5941559-5941581 TACATATTTAAAAAGGATGCAGG - Intergenic
1003483950 6:6558656-6558678 AACATTCTCACAATGGATCATGG - Intergenic
1004405936 6:15333659-15333681 TACATTCTGGAAATGGATAGTGG - Intronic
1005097118 6:22129187-22129209 TACATTTTTAAAATGTAGGTGGG - Intergenic
1005141544 6:22637490-22637512 TAAATTCATAAAATGGTGGATGG + Intergenic
1005972736 6:30774128-30774150 TACATTTTTAAAATGAAAAAAGG + Intergenic
1007497662 6:42271975-42271997 TGCGTTTTTAAAATGGATGACGG + Intronic
1007574015 6:42913157-42913179 TAAATTCTAGAGATGGATGATGG + Intergenic
1008631915 6:53370292-53370314 AACATTCTTAACATAGTTGATGG - Intergenic
1008728293 6:54448691-54448713 TGCATACTTAAAATGGTTGAGGG - Intergenic
1008832377 6:55781192-55781214 TACTTTCTTAAAATAAATGAGGG - Intronic
1009394028 6:63176616-63176638 TAACTTCTTAAATGGGATGAGGG + Intergenic
1009882742 6:69589465-69589487 TACATTTTAAAAAGGGATCATGG + Intergenic
1010058309 6:71590451-71590473 TTCATTCATCAAATGGAAGAGGG + Intergenic
1010367884 6:75073148-75073170 TATAATCATATAATGGATGAAGG - Intergenic
1010762260 6:79736955-79736977 AATATTTTTAAAATGGATAAGGG + Intergenic
1011186265 6:84679683-84679705 TACATTTTTAAAATGTATTTAGG - Intergenic
1011496798 6:87944499-87944521 TTCAATCATAAATTGGATGAAGG - Intergenic
1012260315 6:97080992-97081014 TACATTTTAAAACAGGATGATGG - Intronic
1012499930 6:99877200-99877222 TACATTCTTTAAACAGTTGATGG + Intergenic
1012681661 6:102190334-102190356 TTCATTTTTAAAATAAATGAAGG - Intergenic
1014039563 6:116810271-116810293 CACATTTTTAAAATGAATAAAGG + Intronic
1014103110 6:117533397-117533419 TCCATTTTCACAATGGATGATGG + Intronic
1014662271 6:124187686-124187708 TATGTTGTTAAAAAGGATGAGGG - Intronic
1015481299 6:133713439-133713461 TATATTTTTAAAAAGGATGCAGG - Intergenic
1015867406 6:137741070-137741092 TACATTCTTAGCTTGAATGAGGG + Intergenic
1016052634 6:139546158-139546180 AACATTCTTTTAATGGAAGAAGG + Intergenic
1016090023 6:139965784-139965806 TAAATCCTGAAAATGGATCATGG + Intergenic
1016501619 6:144726736-144726758 GACAGCCTTAAAAAGGATGAGGG + Intronic
1018317673 6:162573112-162573134 GACATTCTAAAAATGGAAAATGG - Intronic
1018405495 6:163477476-163477498 TACTTTGTTAAAATGGATCATGG + Intronic
1018490801 6:164290729-164290751 TATCTTATTAAAGTGGATGAGGG - Intergenic
1020513459 7:9088687-9088709 TACATTCTTAAATTTAATTAAGG - Intergenic
1020779881 7:12503529-12503551 TAATTTTTTAAACTGGATGATGG + Intergenic
1021686325 7:23190546-23190568 TACATTCTTAAAAATCATTAAGG - Intronic
1021711524 7:23420743-23420765 TACAATCATAAAATGGAGGAGGG + Intronic
1022733307 7:33052563-33052585 TACATTGGTTAAATGAATGATGG - Intronic
1022990879 7:35705885-35705907 TAAATCCTTAGAATGAATGAAGG - Intergenic
1023019529 7:35998089-35998111 TACATTTTTAAAATTGTTGTAGG + Intergenic
1023952847 7:44860632-44860654 AACATTTCTAAAAAGGATGATGG + Intergenic
1026225737 7:68438757-68438779 TACATTCTAACAGTGTATGAGGG - Intergenic
1026332369 7:69363909-69363931 GACATTCCAAAAAGGGATGAAGG - Intergenic
1027769344 7:82386842-82386864 TAGAGTCTTTAAATGGATGTAGG - Intronic
1030837226 7:114304373-114304395 TATATTGTTAAAATAGATGCTGG + Intronic
1031497319 7:122466345-122466367 TACATACTTATCCTGGATGACGG + Intronic
1031660046 7:124412362-124412384 CACAGTCTTACAATGGAAGAAGG - Intergenic
1032566217 7:132948898-132948920 TAAATTTTGAAAAGGGATGACGG - Intronic
1033594097 7:142842174-142842196 TACATTTTTAAAATGACAGATGG - Intergenic
1033618729 7:143042475-143042497 TACATGTTTACAATGGCTGAAGG - Intergenic
1036132103 8:6125265-6125287 TACACTCTTAAAATGTATTCAGG - Intergenic
1037213643 8:16423109-16423131 TCCATTCTTAAGGAGGATGATGG + Intronic
1038246537 8:25861732-25861754 AATATTCTTAAAATGATTGATGG + Intronic
1038305192 8:26394401-26394423 TACATTCTTAAAAATCATTAGGG + Intronic
1039687845 8:39826050-39826072 AACATTCTTAAAAGAAATGAAGG - Intronic
1040788364 8:51194325-51194347 TACATTGTTAAGATGTGTGAGGG + Intergenic
1042702574 8:71632345-71632367 TACACTCTTAACTTGGATTAGGG + Intergenic
1044404670 8:91814423-91814445 GACATTCTTAAAATGTTTAAAGG - Intergenic
1044779925 8:95733730-95733752 TCCATTCTTAAAGAGAATGAAGG - Intergenic
1044976682 8:97671875-97671897 TAGATTCCTAAAATGTATTAAGG - Intronic
1045420111 8:102006122-102006144 TACAGTCTTAGAATTGATCATGG - Intronic
1046006497 8:108492624-108492646 TAGATTCTTAAGTTGCATGAGGG + Intergenic
1046059842 8:109125378-109125400 CTCATTATTAAATTGGATGATGG - Intergenic
1048675885 8:136779604-136779626 TACTTTCTAAAAATGGGTAAGGG - Intergenic
1049892273 9:81807-81829 TTTCTTCTGAAAATGGATGAAGG - Intergenic
1051051569 9:12938931-12938953 TAAATTCTTAATATGGAGTAGGG - Intergenic
1051553758 9:18359684-18359706 TACATGATCAAAATGGGTGAAGG - Intergenic
1051599638 9:18859932-18859954 CTCATTCTTTAAATGGGTGATGG - Intronic
1051648975 9:19301318-19301340 TACATTCTTAAAATGGGGAAGGG - Intronic
1052319017 9:27147027-27147049 TACATTCATACAATGAATGTTGG - Intronic
1052609064 9:30745683-30745705 TACATTTTTTAAGTGAATGAGGG - Intergenic
1054799475 9:69333188-69333210 TAGATTGTTAACATGGAGGAGGG + Intronic
1054891099 9:70252767-70252789 TACATCCTTGAAAGCGATGAAGG + Intergenic
1056930027 9:90866548-90866570 TACACCCTTCAGATGGATGAGGG + Intronic
1057609435 9:96527542-96527564 TACGTTCTGAAGATGGATGGTGG - Intronic
1057859634 9:98629866-98629888 TGCAGTATTAAAATGGAGGAGGG - Intronic
1058109889 9:101020798-101020820 AATGTTCTTAAGATGGATGATGG - Intergenic
1060582440 9:124762168-124762190 TACACTCTTAAAAATTATGAAGG + Intronic
1203355516 Un_KI270442v1:135547-135569 TAGATTCTTCAAATGGATTCTGG - Intergenic
1185660374 X:1723229-1723251 TACATAAATAAAATAGATGAAGG - Intergenic
1186183931 X:7001074-7001096 TACATTATTAGAATTAATGAGGG + Intergenic
1187556197 X:20354278-20354300 TACAGTATTAAAATTTATGAAGG + Intergenic
1187671270 X:21668102-21668124 AACATTCTGGAGATGGATGATGG - Intergenic
1187672682 X:21684480-21684502 AACATTTATCAAATGGATGAGGG - Intergenic
1187872516 X:23776260-23776282 CACAATTTAAAAATGGATGAAGG + Intergenic
1189718020 X:43884488-43884510 TATATTTTTAAAAGGGATGGGGG + Intergenic
1189723660 X:43946904-43946926 TAAATGCTTAAAAATGATGAGGG + Intergenic
1190384976 X:49876659-49876681 TACATTTTTAAAACAGATGATGG + Intergenic
1193248425 X:79258923-79258945 TCAATGCTTAAAAAGGATGATGG + Intergenic
1193262151 X:79420706-79420728 AACATTCTTGAAATGGATAATGG - Intergenic
1193526442 X:82596213-82596235 GACATTCTTGACATTGATGAAGG + Intergenic
1196161111 X:112483868-112483890 TAAATTTTTAAAAAGGATTAGGG - Intergenic
1196190207 X:112786509-112786531 TAGATGCTTAATATAGATGAGGG - Intronic
1196325632 X:114399065-114399087 AACATTCTAAAAGTGGAAGAAGG + Intergenic
1196668614 X:118343037-118343059 TACATCTTTAAAAGTGATGATGG + Intergenic
1197992971 X:132338191-132338213 TACTTACTTGAAATGGATGATGG + Intergenic
1201532537 Y:15008104-15008126 AACATTCTGAAGATGAATGATGG - Intergenic