ID: 910654042

View in Genome Browser
Species Human (GRCh38)
Location 1:89601857-89601879
Sequence GATCACAGCCCCAGTGATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910654036_910654042 22 Left 910654036 1:89601812-89601834 CCATGGAGAATTTGCTGAGAAGG No data
Right 910654042 1:89601857-89601879 GATCACAGCCCCAGTGATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910654042 Original CRISPR GATCACAGCCCCAGTGATTT AGG Intergenic
No off target data available for this crispr