ID: 910654414

View in Genome Browser
Species Human (GRCh38)
Location 1:89605415-89605437
Sequence CCTACCATGAAGAGGAGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910654408_910654414 -8 Left 910654408 1:89605400-89605422 CCCTCTTTTCTCTCTCCTACCAT No data
Right 910654414 1:89605415-89605437 CCTACCATGAAGAGGAGGGACGG No data
910654405_910654414 19 Left 910654405 1:89605373-89605395 CCACCAGGAGCACATGGGTCCTT No data
Right 910654414 1:89605415-89605437 CCTACCATGAAGAGGAGGGACGG No data
910654404_910654414 20 Left 910654404 1:89605372-89605394 CCCACCAGGAGCACATGGGTCCT No data
Right 910654414 1:89605415-89605437 CCTACCATGAAGAGGAGGGACGG No data
910654409_910654414 -9 Left 910654409 1:89605401-89605423 CCTCTTTTCTCTCTCCTACCATG No data
Right 910654414 1:89605415-89605437 CCTACCATGAAGAGGAGGGACGG No data
910654406_910654414 16 Left 910654406 1:89605376-89605398 CCAGGAGCACATGGGTCCTTTCT No data
Right 910654414 1:89605415-89605437 CCTACCATGAAGAGGAGGGACGG No data
910654407_910654414 0 Left 910654407 1:89605392-89605414 CCTTTCTTCCCTCTTTTCTCTCT No data
Right 910654414 1:89605415-89605437 CCTACCATGAAGAGGAGGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910654414 Original CRISPR CCTACCATGAAGAGGAGGGA CGG Intergenic
No off target data available for this crispr