ID: 910657797

View in Genome Browser
Species Human (GRCh38)
Location 1:89635464-89635486
Sequence CTTCTTATGTAAAATGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 410}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910657797_910657800 0 Left 910657797 1:89635464-89635486 CCATCCACATTTTACATAAGAAG 0: 1
1: 0
2: 3
3: 55
4: 410
Right 910657800 1:89635487-89635509 GAAGTTCAGAGTTTCTGATTTGG 0: 1
1: 0
2: 4
3: 72
4: 516

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910657797 Original CRISPR CTTCTTATGTAAAATGTGGA TGG (reversed) Intronic
901272599 1:7964284-7964306 CTTCAACTGTAAAATGAGGATGG - Intronic
901809571 1:11759834-11759856 CCTCATATGTAAAAGGGGGATGG - Intergenic
902233524 1:15043397-15043419 CCCCTTATGTAAAATGGGGCAGG - Intronic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903320225 1:22538721-22538743 CATCTTCTGTGAAATGGGGAGGG + Intergenic
903376361 1:22868867-22868889 GTTCTTATGTACAATTTGGTGGG - Intronic
904273188 1:29363678-29363700 CTGCATCTGTAAAATGGGGATGG - Intergenic
904312597 1:29638860-29638882 CTTCTCATGTCAAATGTGACAGG - Intergenic
904330455 1:29754997-29755019 TTTCTTCTGTAAAATGGGAATGG + Intergenic
904416221 1:30362598-30362620 TTTCTTCTGTAAAATGGGGATGG - Intergenic
905698291 1:39992301-39992323 GTGCTTATGTGAAATTTGGATGG + Intergenic
905922640 1:41729603-41729625 CTCCTTCTGTAAAATGAGTAGGG - Intronic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
906672672 1:47667940-47667962 CTTCTCATGTAAAATGAAGCTGG + Intergenic
907318635 1:53588879-53588901 CTTCTTCTGTAAAATGGGCATGG + Intronic
907699260 1:56767255-56767277 CTTCTCATGTAAAAAGATGAGGG - Intronic
909369432 1:74866555-74866577 CTTCTTGTGTAGAATGTTGCAGG + Intergenic
910657797 1:89635464-89635486 CTTCTTATGTAAAATGTGGATGG - Intronic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
915062609 1:153198693-153198715 CATGTTAGGAAAAATGTGGAAGG + Intergenic
916404929 1:164488940-164488962 CTTCATCTGTAAAATGGAGAAGG - Intergenic
916689581 1:167177586-167177608 ATTTTTAAGTAAAATGTTGAAGG - Intergenic
917400198 1:174639715-174639737 CTTGTTATGTAATATTTAGAGGG + Intronic
918200684 1:182263753-182263775 CTTATTTTGAAAAATGTGTAGGG + Intergenic
918639321 1:186819870-186819892 CTGCTTATGCAAAATGGTGAAGG + Intergenic
918872688 1:189997074-189997096 CTTCTTCTGTTAAGTGTGGCTGG + Intergenic
919256794 1:195136064-195136086 ATTTTGATGTAAACTGTGGATGG + Intergenic
919641885 1:200053413-200053435 CTTCATATGTAAAAAGAGGTAGG - Intronic
920033849 1:203053067-203053089 CTTCATCTGTAAAATAGGGATGG - Intronic
920436032 1:205947791-205947813 CCTCATATGTAAAATGAGGGAGG - Intergenic
920534239 1:206727314-206727336 CTTCCTTTGTAAAGTGGGGATGG - Intronic
922210115 1:223479829-223479851 ATTCTTATGTTAAAGCTGGAGGG - Intergenic
922714659 1:227860753-227860775 CTTCTAATGGCAACTGTGGAAGG + Intergenic
923262419 1:232279830-232279852 CTTCCTCTGTAAAATGAGGATGG + Intergenic
924157887 1:241199941-241199963 CTTCATCTGCAAAATGTGGGTGG + Intronic
924299277 1:242620813-242620835 CTCCTCATGGACAATGTGGAGGG - Intergenic
924592594 1:245417868-245417890 TTTCTCATCTAAAATTTGGAGGG - Intronic
1063181126 10:3601426-3601448 CCTCTCATGGAAAAGGTGGAAGG + Intergenic
1064138183 10:12768359-12768381 ATTCTTATGTAGAGTGTGAAAGG - Intronic
1064935504 10:20674536-20674558 CTTGTTAGGTAATATCTGGAAGG - Intergenic
1067680788 10:48438875-48438897 CTCCTTTTGTAAAATGTAAATGG - Exonic
1069652817 10:70063085-70063107 TTTTTTTTGTAAACTGTGGAGGG - Intronic
1070394764 10:76002497-76002519 CTACATCTGTAAAATGGGGATGG + Intronic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1071305072 10:84292499-84292521 CTTCATCTATAAAATGAGGATGG - Intergenic
1071526157 10:86360412-86360434 CTTATTATATAAAATGTGGAAGG - Intronic
1071710203 10:88042394-88042416 CTTGATATGAAAAATGTGAATGG + Intergenic
1071823744 10:89303728-89303750 TTTCTTTTGTAAAATGAGAAAGG + Intronic
1071932499 10:90488253-90488275 CCTCTTATGTAAAGTGGGGAAGG - Intergenic
1072085537 10:92075936-92075958 TTTCTTGTGTACAGTGTGGAAGG - Intronic
1072627575 10:97123092-97123114 CTTCATCTGTAAAGTGGGGATGG - Intronic
1072632002 10:97152655-97152677 CTTCTTATTTAAAAACTGGGAGG + Intronic
1072706739 10:97686652-97686674 CTGCTTCTGTAGATTGTGGAAGG + Intronic
1072832919 10:98678261-98678283 CTTCTTCTCTGACATGTGGATGG - Intronic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1074125370 10:110524921-110524943 CTTCTTGTGTGAAATGAAGAAGG + Intergenic
1074662951 10:115682990-115683012 CATCTTCTGTAAAAGGGGGATGG + Intronic
1074805414 10:117045864-117045886 GTTCTAATGAAAAAAGTGGATGG + Intronic
1074872929 10:117591341-117591363 GTACTTATGTAAAATGTGTATGG - Intergenic
1074902668 10:117832494-117832516 CTTCTTTTATGAAATGTGGGGGG - Intergenic
1074988617 10:118681296-118681318 ATGCTTATGAAAAATTTGGAGGG - Exonic
1075764237 10:124879949-124879971 CTTATTATATAAAAAGAGGACGG + Intergenic
1075909041 10:126107704-126107726 ATTCTCATGTGCAATGTGGATGG - Intronic
1078294982 11:10058668-10058690 CTTCTTGTGTAGAATGTTGCAGG - Intronic
1079206913 11:18423883-18423905 CTTCTTTTGTAAATTATTGAAGG - Intronic
1079327776 11:19509158-19509180 CCTCTTCTGTAAAATGGGGTTGG + Intronic
1080309923 11:30878128-30878150 CACTTTATGTAAAATGCGGAGGG + Intronic
1080854449 11:36100140-36100162 CTTCTTAAGTAAAACGCCGATGG - Intronic
1081064119 11:38519154-38519176 CACCCTATGTAAAATGTGTAGGG + Intergenic
1081428916 11:42954837-42954859 GTCCTTATGTAAAATATGGAAGG - Intergenic
1083008341 11:59369768-59369790 CTTCTTGTGTAGAATCTTGAAGG - Intergenic
1083116648 11:60466316-60466338 CTTCAACTGTAAAATGGGGATGG + Intronic
1085067479 11:73510555-73510577 CTTCCTCTGTAAAATGAGCAGGG + Intronic
1085663763 11:78394368-78394390 CTTCTTTTGTGGACTGTGGAGGG - Intronic
1085674919 11:78507393-78507415 CTTCTTTTTTAAATTGTTGAAGG - Intronic
1086044983 11:82522156-82522178 CCACATATGTAAAATGTAGATGG - Intergenic
1087251170 11:95902176-95902198 CTTTCTATGTAAAATGGCGATGG + Intronic
1087872269 11:103310996-103311018 CTTCTTCTTTAAAAAGTGGCTGG - Intronic
1088202943 11:107359747-107359769 TTTCCTTTGTAAAATGTAGATGG - Intronic
1092180656 12:6444632-6444654 ATTCGTCTGTAAACTGTGGACGG + Intergenic
1093484406 12:19637932-19637954 CTTTTTCTGCAAAATGGGGATGG + Intronic
1093804569 12:23416368-23416390 CTTCTTATTTAAACAGTGGGAGG - Intergenic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1095656509 12:44675735-44675757 CATCCTATGTAAAATGGGAAAGG + Intronic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1097454669 12:59783173-59783195 TTTCATATGTAGAATGTGGAAGG + Exonic
1097992524 12:65851141-65851163 CTTCTTTTGTGAAATGAGGCTGG + Intronic
1098141715 12:67456764-67456786 CTCCTTATGCAAAGTCTGGATGG + Intergenic
1098512569 12:71334765-71334787 ATTCTTATGGAAAATATGAAGGG + Intronic
1098685765 12:73418166-73418188 GTTTTTGTTTAAAATGTGGATGG - Intergenic
1098992825 12:77083948-77083970 CAAATTATGTAAAATGTAGAAGG - Intergenic
1099084703 12:78231283-78231305 CTTGATATTTAAAATATGGAAGG + Intergenic
1099162586 12:79261657-79261679 CTTATTATTTAAAATGGGAAAGG + Intronic
1099347607 12:81522688-81522710 CTTCTGAGGAAAAATTTGGACGG - Intronic
1100727699 12:97426380-97426402 CTTGTTATTTAAAATTTGGCAGG - Intergenic
1101946594 12:109141925-109141947 GTACCTCTGTAAAATGTGGAAGG + Intronic
1102514717 12:113438659-113438681 CTGCATCTGTAAAATGGGGATGG - Intergenic
1102529207 12:113533542-113533564 CTTGTTAAGTAAAATGAGAACGG + Intergenic
1102912558 12:116728734-116728756 CTTCCTCTGTAAAATGGAGATGG - Intronic
1102946648 12:116995294-116995316 TCTCTTCTGTAAAATGAGGAGGG + Intronic
1103042353 12:117705908-117705930 ATTCTTCTGTAAAATGGGGCTGG + Intronic
1103197242 12:119055403-119055425 CTTCTTATGGAAACCCTGGAGGG - Intronic
1103560065 12:121788962-121788984 CATTTTAGGTAGAATGTGGAGGG - Intronic
1106025671 13:25953318-25953340 TTTCTTCTGTAAAATGGGGACGG + Intronic
1106415891 13:29545453-29545475 CTACGTGTGTAAAATGGGGATGG + Intronic
1106751701 13:32778169-32778191 CTTCTCATGCAAAATGTTGGCGG + Intergenic
1106808072 13:33332015-33332037 TTTATGATGTAAAATGTGGAAGG - Intronic
1108357882 13:49643569-49643591 CTGCCTAAGTAAAATGGGGAAGG - Intergenic
1109788873 13:67221280-67221302 TATGTTATGTAAAATGCGGAAGG - Intronic
1110143152 13:72155799-72155821 CTACTTGTGTTAAATGTTGAGGG + Intergenic
1110300590 13:73922223-73922245 ATTCATATGTAAAATGTTTAAGG - Intronic
1110585670 13:77188520-77188542 CTTCATGTGTACAATGGGGATGG + Intronic
1110881068 13:80573221-80573243 CTGCTTCTGTAAAATGCGAATGG + Intergenic
1111482858 13:88854735-88854757 ATTCTTAAGCAAAATGTTGAAGG + Intergenic
1112345860 13:98588847-98588869 ATACTTATGAAAGATGTGGATGG + Intergenic
1112773744 13:102821743-102821765 CTTCTTGGGTAATAGGTGGAAGG - Exonic
1112818540 13:103302654-103302676 TTTCATCTGTAAAATGGGGATGG + Intergenic
1113963829 13:114140508-114140530 CTTCGTCTGTAAAATGGGGCTGG + Intergenic
1116444509 14:44992930-44992952 CTTTTTATGAAAAATATGCAGGG + Intronic
1116815367 14:49578988-49579010 CCTCATTTGTAAAATGGGGACGG + Intronic
1117653546 14:57931080-57931102 CTTCCTCTGTAAAATGAGGGAGG - Intronic
1118537533 14:66784573-66784595 AATCATATTTAAAATGTGGAAGG + Intronic
1118595180 14:67429903-67429925 CTTCATTTGTAAAATGAGGAAGG - Intergenic
1118743703 14:68759068-68759090 CTTCATGTGTAAAATGCAGAGGG - Intergenic
1119142423 14:72279457-72279479 CTTCTTATGGAGGATCTGGAAGG - Intronic
1119240593 14:73056297-73056319 TTTCTTTTAAAAAATGTGGAGGG + Intergenic
1119548365 14:75489966-75489988 CTTCATCTGTAAAATGTGGGGGG + Intergenic
1119895321 14:78214976-78214998 CTTCGTCTGTAAAATGGGGGTGG + Intergenic
1120256526 14:82126727-82126749 CTTCATCTGTATAATGTGAATGG - Intergenic
1121075359 14:91063609-91063631 CTTCATATGTGTAATATGGAGGG + Intronic
1121095546 14:91215826-91215848 CTTCATCTGTAAAATGGGGGTGG + Intronic
1121373979 14:93388751-93388773 CTTCTTTTGTAAGATATTGAAGG + Intronic
1124458871 15:29870659-29870681 CACATTATGTAAAATCTGGAGGG - Intronic
1124683456 15:31757275-31757297 CTTCTTTTATACAATGTGGATGG + Intronic
1125106374 15:35976586-35976608 ATTCTTTTATAAAATGGGGAGGG - Intergenic
1125421051 15:39504420-39504442 CTTCCTCTGTAAAATGAGGCTGG - Intergenic
1126002114 15:44220503-44220525 CTTCATTAGTAAAATGTGGGAGG + Intergenic
1126457995 15:48885313-48885335 CCTTTTATATAAAATGTGGGGGG + Intronic
1126509582 15:49453850-49453872 ACTCTTATGTAAAATGTATAAGG - Intronic
1127116933 15:55738326-55738348 CTTCATAAATAAAATGTGAATGG - Intronic
1127830909 15:62750390-62750412 CTTCTTCTGTAGACTGTGAAGGG + Exonic
1128522501 15:68385115-68385137 CTTCATCTGTAAAATGGGTATGG - Intronic
1128610480 15:69069161-69069183 CTTCATCTCTAAAATGGGGATGG - Intergenic
1128650169 15:69405954-69405976 CTTCCTATGCAAAATGAGAAGGG + Exonic
1128749515 15:70139073-70139095 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128749649 15:70139932-70139954 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128869121 15:71138976-71138998 CTTCATCTGTAAAATGGGGGGGG - Intronic
1130074896 15:80680164-80680186 CTACTTATGTAAACAGTGCAAGG + Intronic
1130094158 15:80843899-80843921 CTTCTTCTGTAAAACAAGGAGGG - Intronic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1131805997 15:96123331-96123353 CTTTTGATGTAAAATGTTGTGGG - Intergenic
1131934246 15:97484847-97484869 CTTCTTATTTAAAATGTGTGTGG + Intergenic
1133169823 16:3975405-3975427 TTTCTTAAGTAAACTGAGGACGG + Intronic
1134260200 16:12644990-12645012 CTTCATCTGTAAAATGGGGAAGG - Intergenic
1134784356 16:16927606-16927628 TTTCATCAGTAAAATGTGGATGG + Intergenic
1136237369 16:28923002-28923024 CTTCCTCTGTAAAATGGAGATGG + Intronic
1137478223 16:48829219-48829241 CGTCTTATGGAAGAGGTGGATGG - Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138555264 16:57767152-57767174 CATCATCTGTAAAATGGGGATGG - Intronic
1138986780 16:62338588-62338610 CTTCATAAGTAGAATGTGTAGGG - Intergenic
1139416134 16:66812279-66812301 CTTCATGTGTAAAATGGGGCCGG + Intronic
1140042852 16:71420513-71420535 CTTCTTATAGAAAGTCTGGAAGG - Intergenic
1140342711 16:74180843-74180865 CTTGTTATGTAAACTGTGCCAGG + Intergenic
1140492874 16:75354665-75354687 CTTCTTTTCTTAAATGTGGTGGG + Intronic
1140587022 16:76304916-76304938 CTACTGATGTACAATTTGGATGG - Intronic
1141310761 16:82911542-82911564 CTCCATCTGTAAAATGGGGATGG + Intronic
1142839608 17:2617338-2617360 TTTCCTATGTAAATTTTGGATGG + Intronic
1143833804 17:9673908-9673930 CTTCTTCTGTACAATAAGGAGGG + Intronic
1144036302 17:11369004-11369026 CTTCATCTGTAAAATGGGAATGG - Intronic
1144378531 17:14669708-14669730 CCTCATCTGTAAAATGTAGATGG - Intergenic
1144765869 17:17732134-17732156 CTTCATCTGTAAAATGGGGATGG - Intronic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146648061 17:34588642-34588664 ATTCTTATGTATATTGTGGGTGG + Intronic
1147128736 17:38392936-38392958 CTTTATATGTGAAATGGGGATGG + Intronic
1147493550 17:40894336-40894358 TTTCATTTGTAAAATGAGGATGG - Intergenic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1153680126 18:7492541-7492563 CCTCATTTGTAAAATGGGGATGG + Intergenic
1153760804 18:8330137-8330159 TTTCTTCTGTAAAATGGGGTAGG - Intronic
1155062286 18:22239443-22239465 CAAGTTATGTAAAGTGTGGAGGG - Intergenic
1155540752 18:26865556-26865578 CTTCTTAGGCAGAATCTGGAAGG - Intronic
1155967454 18:32049346-32049368 CATCATTTGTAAAATGGGGATGG + Intronic
1156470249 18:37373324-37373346 CTTCTGATTTCAGATGTGGAGGG + Intronic
1157109780 18:44809773-44809795 CTTCTCATATATAATTTGGATGG - Intronic
1157165382 18:45354036-45354058 CTTCATCTGTAAAATATTGAAGG + Intronic
1158194099 18:54865679-54865701 CTTCTTTTGAAGAATTTGGAGGG + Intronic
1158784555 18:60693850-60693872 ATTTTAATGTACAATGTGGATGG + Intergenic
1159814962 18:73061992-73062014 CTGCTTATGTGAAATACGGAGGG + Intergenic
1160302789 18:77700843-77700865 GTTTTTGTGTCAAATGTGGATGG + Intergenic
1161451261 19:4346724-4346746 TTTCTTATGTGAAATGGAGATGG + Intronic
1161616907 19:5276019-5276041 CCTCACATGTAAAATGGGGATGG - Intronic
1164366339 19:27586577-27586599 CTTCTTTTGTAGAATCTGCAAGG + Intergenic
1164369315 19:27628907-27628929 CTTCTTATGTAGAATCTGCAAGG + Intergenic
1165262572 19:34633168-34633190 CTTCTCTTGGAAAATGTGAATGG + Intronic
1165978631 19:39700178-39700200 CTTTTTATGGAAATTGTGAATGG - Intergenic
1167948972 19:53011302-53011324 TTTCTTATGAAAGAAGTGGAAGG - Intergenic
1168462287 19:56569015-56569037 GTTCTTAGGTAAAATGGAGATGG + Intronic
925139948 2:1543221-1543243 CTTCACATGTGAAATGAGGACGG - Intronic
925420756 2:3709374-3709396 CCGCTTCTGTAAGATGTGGAGGG - Intronic
926809012 2:16740075-16740097 CTTCATCTATAAAATGAGGAAGG - Intergenic
926882311 2:17559579-17559601 CATCATATGTAAAATGAGTAGGG + Intronic
926928406 2:18011770-18011792 CCTCTTCTGTGAAATGGGGATGG + Intronic
927032050 2:19131123-19131145 CATGTTGTGTAAAATGTGGCAGG + Intergenic
928187131 2:29121403-29121425 CTTCTAATGGAAAATCTGGAAGG - Exonic
928409791 2:31046116-31046138 TTTTATATGTAAAATGTGGATGG - Intronic
928498824 2:31865361-31865383 TCTCATTTGTAAAATGTGGAGGG - Exonic
929666842 2:43839969-43839991 CTTCTCAGGTAAAATGAGGAAGG - Intronic
929844732 2:45511700-45511722 CTTCTTATGAAAAGTGCAGAAGG - Intronic
929996587 2:46829856-46829878 CGTCTTCTGTAAAATGTGCATGG - Intronic
930561036 2:52960105-52960127 TTCCTTATTTAAAATGTGGTCGG + Intergenic
931020194 2:58035701-58035723 CTTCTTCTATATAATTTGGAAGG + Intronic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931523498 2:63126419-63126441 CTTCATCTGTAAAATGAGAATGG - Intronic
932043351 2:68322308-68322330 CTTCATTTGTAAAATGATGATGG + Intergenic
932123667 2:69124394-69124416 CCTCTTTTGTAAAATGTCGGGGG - Intronic
932281372 2:70495358-70495380 ATGCTCATGTAAAATGTGGAGGG - Intronic
936475122 2:112833062-112833084 CTACTTAGGTAAAATGGTGATGG + Intronic
938695554 2:133832314-133832336 CTACTTTTGTCAAATGTGGAGGG + Intergenic
938770613 2:134498106-134498128 CCTCTTAGGTAAAATGGAGATGG - Intronic
938924279 2:136024944-136024966 CTCCTAATGTAAAAGCTGGAAGG - Intergenic
939434802 2:142161591-142161613 CTTTTTATGGAAATTGTGAATGG - Intergenic
939449071 2:142349082-142349104 CTTCCTATTTTAAATGTAGAGGG - Intergenic
939679510 2:145112904-145112926 CTTCATTTGTAAAATGTGGTTGG + Intergenic
940421129 2:153479712-153479734 CAGCTTATGGAAAATGGGGAGGG - Intergenic
940778405 2:157907690-157907712 CTTAATATGTAAATTTTGGAGGG + Intronic
941409116 2:165131272-165131294 CTTGGTCTGTCAAATGTGGAGGG - Exonic
941635089 2:167927536-167927558 CTTCATTTTTAAAATGGGGATGG + Intergenic
942555586 2:177169342-177169364 ATTTTTATGAAAAATGGGGAGGG - Intergenic
943405650 2:187480434-187480456 TTTCCAATGTAAAATGAGGATGG - Intronic
944258787 2:197653761-197653783 TTTCTTATGGAAAAAGTGGATGG - Intronic
944737057 2:202576874-202576896 CTTCTTTTGAAAAATGCTGATGG + Intergenic
944865762 2:203859980-203860002 CTTCTTTTGTAAAATGGAAATGG + Intergenic
944977128 2:205066591-205066613 CTTCATCTGTAAAATGAGAAAGG + Intronic
945363152 2:208916771-208916793 CATCTTGTGTAGAATGAGGAAGG - Intergenic
945884066 2:215355927-215355949 ATTCTTCTGTAAAATGGGGATGG + Intergenic
946095138 2:217268041-217268063 CTTTTTATGGAAAATTTGGTGGG - Intergenic
946895648 2:224320447-224320469 CTGCTTATATAAGATGTGAAGGG + Intergenic
947277189 2:228405621-228405643 CTTCATAAATAAAATGTAGATGG + Intergenic
947372222 2:229459541-229459563 CTTCGTCTGTAAAAAGTAGATGG - Intronic
949054200 2:241916473-241916495 CTTCTTGTGTAAAATCTTGCAGG - Intergenic
1168767874 20:394342-394364 GTTCTAATATAAAATGTAGAAGG - Intronic
1169055860 20:2620185-2620207 CTGCTTATAGAAAATGTGCAAGG + Intronic
1169268079 20:4179746-4179768 CCTCTTCTGTAAAATGGGCATGG + Intronic
1169790540 20:9405364-9405386 CATCTGATTTAAAATGTGCAAGG - Intronic
1170217426 20:13906344-13906366 TTTCTTATATAAAAAGTAGAAGG - Intronic
1170357660 20:15509775-15509797 CTTCATCTGTAAAATAGGGAGGG + Intronic
1170784837 20:19458808-19458830 ATTCTTATTTAAAAAATGGATGG - Intronic
1171153473 20:22848558-22848580 TGTCTTTTGTGAAATGTGGATGG + Intergenic
1172890633 20:38261136-38261158 CTTCATCTGTAAAATGGGGTGGG + Intronic
1172970714 20:38871262-38871284 GTTCTTATGTAACATGGGGCTGG - Intronic
1173092164 20:39983391-39983413 CCTCTCATGTAAAGGGTGGAGGG + Intergenic
1174947558 20:55005023-55005045 ATTCTTAAGTGAAATGGGGAGGG + Intergenic
1175300362 20:57938575-57938597 CTTTATCTGTAAAATGGGGATGG + Intergenic
1177005527 21:15667918-15667940 CTTCTTACGTCAAATGTTGATGG + Intergenic
1177918100 21:27116047-27116069 CCTCTTCTATAAAATGAGGAAGG + Intergenic
1180911084 22:19450824-19450846 TTTCTTATGAGTAATGTGGATGG - Intronic
1181912282 22:26248243-26248265 CTTCATCTGTAAAATGTGAATGG + Intronic
1182096282 22:27628110-27628132 TTTCATCTGTAAAATGGGGATGG - Intergenic
1182168164 22:28197523-28197545 CTTCATCTCTAAAATGGGGAAGG + Intronic
1184469040 22:44685114-44685136 CCTCTTCTGAAAAATGTGGGTGG + Intronic
1184581754 22:45422677-45422699 CTTCTTCTGTAACATGAGGATGG + Intronic
1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG + Intronic
949510041 3:4759540-4759562 CCTCATCTGTGAAATGTGGAAGG + Intronic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950611695 3:14131124-14131146 CTTCGTGTATAAAATGGGGACGG + Intronic
951542470 3:23795312-23795334 CTAATTGTGTAAGATGTGGAAGG - Intergenic
951977246 3:28526073-28526095 CCTCATATGTAAAATGGGGATGG + Intronic
952844837 3:37679556-37679578 CTTCATCTGTAAAATGTGAAGGG + Intronic
953279774 3:41542990-41543012 ATTCTTATGTAAAAGGAAGAAGG + Intronic
953393329 3:42546889-42546911 CTTCTTAAGTCAAATGTGGACGG - Intergenic
954428690 3:50457727-50457749 CTTCATATATAAAAGGTGGAGGG - Intronic
954446302 3:50548721-50548743 CTTCATCTGTAAAATGGGGCAGG - Intergenic
954856429 3:53647709-53647731 CTTCATTTGTTGAATGTGGAGGG + Intronic
955203702 3:56876179-56876201 CTGCATGTGTAAAAGGTGGAAGG + Intronic
955783368 3:62509763-62509785 CTTCCTATGTAAAAAGTGGTAGG + Intronic
956206612 3:66761554-66761576 CCTCATATGTAAAATGAGAAGGG + Intergenic
956614525 3:71157781-71157803 CTTCTATTCTAAAGTGTGGAGGG + Intronic
956740984 3:72275878-72275900 CCTCTTCTGTAAAATGGGGATGG - Intergenic
956741720 3:72280732-72280754 CTTCATCTGTAAAATGGGGATGG - Intergenic
956792046 3:72687424-72687446 CATCATGTGTAAAAAGTGGACGG - Intergenic
957340203 3:78885837-78885859 CTTCATCTGTAAAATGGGCAGGG - Intronic
957550805 3:81701375-81701397 CTAGTTTTTTAAAATGTGGATGG + Intronic
957710846 3:83857766-83857788 TTTCATATGTAAAATGTGGATGG - Intergenic
959494765 3:107037349-107037371 CTTCTTATGACAATTGTGAATGG - Intergenic
959799122 3:110469527-110469549 ATTCTTTTGTCAAATGTTGAAGG - Intergenic
960841725 3:121965328-121965350 CTTCTTGTGTAAAATCTTGCAGG - Intergenic
960923836 3:122777326-122777348 CTACTTGAGTAAAAAGTGGACGG + Intronic
962225032 3:133598781-133598803 CTTCTTGTTTAAAAAGGGGAGGG - Intronic
962929593 3:140024093-140024115 CTTCTTCTGCAAAATGGGGGTGG + Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
962950241 3:140211994-140212016 CATCTGATGTAAAATATGGATGG - Intronic
963522967 3:146379221-146379243 CTTTTTATTTAACATGAGGAAGG + Intergenic
964166612 3:153714435-153714457 CTGCTAAAGTAAAATGTGGATGG - Intergenic
965730404 3:171765663-171765685 CTTGATCTGTAAAATGAGGAAGG + Intronic
965843672 3:172937132-172937154 ATTCTGATGTCAAATGTGTAGGG - Intronic
966111420 3:176406711-176406733 ATAATTATGTAAAATGTGAATGG - Intergenic
966744211 3:183260186-183260208 TATCTTCTGCAAAATGTGGAGGG + Intronic
967342485 3:188415167-188415189 CTTCAGATGTAAAATACGGAGGG - Intronic
968790528 4:2658197-2658219 CTTCATATGTAAACTGCAGATGG - Intronic
970774983 4:19662944-19662966 CTTATTATGTCAAAGCTGGAAGG - Intergenic
970814075 4:20132765-20132787 CTAACTATGTAAAATGTGAAAGG + Intergenic
971482359 4:27125988-27126010 CTTGTTATGTCTCATGTGGAGGG - Intergenic
973177962 4:47231366-47231388 TTTCATCTGTAAAATGAGGAGGG + Intronic
973212305 4:47630326-47630348 CATCTTACGTAAAAGGTGGCTGG + Intronic
973267973 4:48230349-48230371 CTTCATTTGTAAAGTATGGAAGG + Intronic
975438664 4:74384185-74384207 CTTCATCTGTAAGATGAGGATGG + Intronic
977636204 4:99301522-99301544 CTTCATCTGTACAATGTGCATGG - Intergenic
977638249 4:99325683-99325705 CTTCATCTGTAAAATGTGCATGG - Intergenic
981666094 4:147228483-147228505 TTCCTTATCTAAAATGAGGACGG - Intergenic
982289465 4:153765315-153765337 CTTCATCTGTAAACTGTGGATGG - Intergenic
982673136 4:158346307-158346329 ATGCTTATGTTAAATGTGAAAGG + Intronic
982930290 4:161396229-161396251 CTGATTAAGTAAAATGTGGTGGG + Intronic
983955677 4:173696300-173696322 CTTTTTATGTAAAAATTGGTTGG - Intergenic
985014430 4:185618945-185618967 CTTCCTAGGATAAATGTGGAGGG + Intronic
985343784 4:188979748-188979770 TTTTTTATGTATAATGTTGATGG + Intergenic
986211482 5:5677074-5677096 TTTCTTATGTAAAATATGATGGG + Intergenic
986487040 5:8248154-8248176 CATCTTATATAAGAAGTGGAAGG - Intergenic
986507472 5:8467279-8467301 TTTCTTTTGTAAAATTTTGAAGG + Intergenic
987002817 5:13677819-13677841 GTTTCTGTGTAAAATGTGGAAGG + Intergenic
987370318 5:17187072-17187094 ACTCTTCTATAAAATGTGGACGG + Intronic
987783609 5:22469934-22469956 TTACTTATGTCAAATGTGAAAGG - Intronic
988422317 5:31021599-31021621 TTTCTTATGTCTAATGTGCAAGG + Intergenic
988881668 5:35510000-35510022 CTTCTTATAAGATATGTGGAAGG - Intergenic
989127643 5:38072612-38072634 CTTCATCTGTAAAAGGGGGAGGG + Intergenic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
990743166 5:58933125-58933147 CTTATTATGCAAAATGGAGAAGG - Intergenic
991228106 5:64296442-64296464 CTTCTTGTTTAACATTTGGATGG - Intronic
991513329 5:67404908-67404930 CCTCATCTGTAAAATGTAGATGG + Intergenic
991936466 5:71806666-71806688 CTTTTTATTTAAAAAGTGGTGGG + Intergenic
992132517 5:73707322-73707344 GTCCGTATGTAAAGTGTGGAAGG + Intronic
993245474 5:85446102-85446124 CTTCTCAATTAAAATGTTGATGG + Intergenic
994518269 5:100797099-100797121 CTTCTTTGATAAATTGTGGAGGG - Intergenic
994789789 5:104208830-104208852 TTTCTTATTTAAAATTGGGAAGG + Intergenic
997025765 5:130059104-130059126 TATCTTCTGTAAAATGTGGATGG + Intronic
999014183 5:148080687-148080709 CTTCTCATGTAAAATATAGGAGG + Intronic
999051435 5:148527915-148527937 CTGTATATGTAAAATGTGTAAGG - Intronic
999237492 5:150107785-150107807 TTCATTATGTAAAATGGGGAAGG + Intronic
999564814 5:152847019-152847041 CTTCTTATGTGAATTTTGGCAGG + Intergenic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
1000053117 5:157578967-157578989 GTACTTATGTAAAATGTGAGTGG - Intergenic
1000198355 5:158983000-158983022 CCTCTTAGGTAAAGTGTGGCAGG - Intronic
1001109336 5:168882948-168882970 CATCTTCTGTAAAATGGGGATGG - Intronic
1002038335 5:176490698-176490720 ATTCTTAAATAAAATGGGGATGG - Intronic
1002638751 5:180620608-180620630 CATCTTCTGTAACATGAGGAGGG - Exonic
1003272070 6:4615959-4615981 CTTCTTATGTAAAAGATGTGAGG - Intergenic
1003849864 6:10210470-10210492 CTGGTTATGTAAAATGTGACTGG - Intronic
1004204741 6:13581948-13581970 GATCTTATCTAAAAGGTGGAAGG - Intronic
1005238121 6:23790091-23790113 CATTATATTTAAAATGTGGAAGG - Intergenic
1006383271 6:33713790-33713812 TTTCTTATGAAAAATGCAGATGG - Intergenic
1007256592 6:40534025-40534047 TTTCTCATGTAGAAAGTGGAAGG - Intronic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1008863983 6:56187655-56187677 TTTCTTATGTGAAATGAGGTAGG - Intronic
1009449831 6:63788053-63788075 CTACTTATTTCAAATGTTGAGGG - Intronic
1009671392 6:66756355-66756377 CTACTTACGTAACATGTGGTAGG + Intergenic
1009690459 6:67025341-67025363 CTGCATATTTAAAATTTGGAGGG - Intergenic
1011050061 6:83136861-83136883 CTTCTTTTAGAAAAGGTGGAAGG - Intronic
1012784536 6:103606629-103606651 TTTCATATATAAAATGAGGATGG + Intergenic
1012942644 6:105431765-105431787 ATTTTTAAGTTAAATGTGGAAGG + Intergenic
1013880402 6:114892474-114892496 CTGCTTATGTATAAAATGGATGG - Intergenic
1014018037 6:116556666-116556688 CTTCTTATGTAAAGTGAGAGAGG - Intronic
1015156280 6:130100228-130100250 TTTCATCTGTAAAATGAGGATGG - Intronic
1015161831 6:130160809-130160831 TTTCAAATGTAAAATGTGGAAGG + Intronic
1015488470 6:133798968-133798990 CTTCTTATGTAGAATCTTGCAGG + Intergenic
1015494214 6:133863932-133863954 CTTCTTGTGTAGAATATTGAAGG + Intergenic
1016510592 6:144838651-144838673 CTTTATTTGTAAAATGGGGAGGG - Intronic
1017732675 6:157331473-157331495 CTTCCTCTGTAAAGTGAGGAAGG + Intergenic
1018124858 6:160672002-160672024 CTTCTTGTGTAGAATCTGGCAGG - Intergenic
1018637643 6:165878161-165878183 CTGATTTTGTAAAATGTGGCAGG - Intronic
1019149278 6:169993548-169993570 CTTCTTAAGTAAAATGGAGCAGG + Intergenic
1020434004 7:8142655-8142677 CTTGTCATGTAAAAGATGGAAGG - Intronic
1020678135 7:11204127-11204149 CTACCTCTGTAAAATGGGGACGG + Intergenic
1020977937 7:15030927-15030949 ATTCTCAAGTAAAAAGTGGAAGG - Intergenic
1021837046 7:24687766-24687788 ATTTTTATATAAAATGTGGTTGG + Exonic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1023165042 7:37335465-37335487 ATGCTTATGAAAAATATGGAAGG + Intronic
1023529077 7:41134929-41134951 CATCCTATGTAAAATTTTGAGGG + Intergenic
1023633252 7:42184011-42184033 CCTCTTCTGTAAAATGGGGAGGG + Intronic
1023681638 7:42693596-42693618 CTAATTATTTAAAATTTGGAAGG - Intergenic
1024912934 7:54466773-54466795 CTTCATATGGAAAAGGTGGAAGG + Intergenic
1025098859 7:56118700-56118722 ATTCTTATGTAAAAAGAGGTTGG - Intergenic
1025310387 7:57930044-57930066 CTCTTTATGTAAAATCTGCAAGG - Intergenic
1027880387 7:83828153-83828175 TTTATCATATAAAATGTGGAAGG + Intergenic
1028144872 7:87310574-87310596 CTTATTTTGTAAAAGGTAGAAGG - Intergenic
1028283350 7:88961954-88961976 ATTCTAATGTAAAATGTAAAAGG - Intronic
1030225911 7:107150506-107150528 TTTCTTGTCAAAAATGTGGAGGG - Intronic
1030521188 7:110600060-110600082 CTGCAAAAGTAAAATGTGGAAGG + Intergenic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1030697646 7:112603681-112603703 CTTTATCTGTAAAATGGGGATGG - Intergenic
1030804902 7:113904328-113904350 CTTCTTATGTGAAATGGGACTGG + Intronic
1030931426 7:115527680-115527702 CTTCTTAGGGAAAATGGAGATGG + Intergenic
1031492605 7:122407499-122407521 TTTCATATGTGAAATGGGGAGGG - Intronic
1031977617 7:128103989-128104011 CTTCATCTGTAAAATGGGGGTGG - Intergenic
1032571786 7:133008145-133008167 CTTCCTAAGTGAAATGTGCATGG + Intronic
1032597615 7:133257332-133257354 CTGCTGATGTACAATTTGGATGG + Intronic
1033025142 7:137764909-137764931 CCTCTTGGGTAAAATGTGGAAGG - Intronic
1033063995 7:138135249-138135271 CTTCTAATGCAAAATGTGTAGGG - Intergenic
1033811664 7:145020831-145020853 CTTTTTCTGTAAAACGGGGATGG + Intergenic
1033851037 7:145495201-145495223 CTTATCATGTATAATGTTGATGG + Intergenic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1036408859 8:8479749-8479771 CTTCCCCTGTAAAATGAGGATGG - Intergenic
1037090997 8:14918782-14918804 GTTCTTAGTTAAAATGAGGAAGG - Intronic
1037287241 8:17314415-17314437 CTTCATTTTTAAAATGGGGAAGG + Intronic
1038712377 8:29959527-29959549 CTTCTTTTGTAAAAGGAGAATGG - Intergenic
1039783670 8:40813324-40813346 CTTCTTCTGTAACATGAGGTTGG - Intronic
1040638131 8:49299680-49299702 ATTTTTATCTAAAAGGTGGAAGG - Intergenic
1041489212 8:58412766-58412788 CTTCATTTGTAAACTGAGGAAGG + Intronic
1041848539 8:62359847-62359869 TTTCTTGTGTAAAAAGTAGATGG + Intronic
1044043852 8:87404461-87404483 CTTGTTCTGTGAAAAGTGGAGGG - Intronic
1044371531 8:91417957-91417979 CATATTATGTAAAATTTGGAAGG - Intergenic
1044474141 8:92606346-92606368 CTTCTTTTGTAAGATGTGATCGG - Intergenic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1045147073 8:99357959-99357981 CTTCATTGGTAAAATGGGGATGG + Intronic
1045189475 8:99868779-99868801 TTTCCTATGATAAATGTGGAAGG + Intronic
1045256361 8:100526979-100527001 CTTCACACGTATAATGTGGAAGG + Intronic
1045261200 8:100575983-100576005 CTTTGTCTGTAAAATGTAGATGG - Intronic
1046540057 8:115568189-115568211 ATTCTTATATAAAATGTGTCTGG - Intronic
1047448507 8:124941446-124941468 CTTCACCTGTAAAATGAGGATGG - Intergenic
1047957835 8:129988751-129988773 CTTGTTATGTAAATTATGGCGGG + Intronic
1048127381 8:131651164-131651186 ATTCATATGAAAAATGAGGATGG + Intergenic
1048132391 8:131712122-131712144 CTTTTTGACTAAAATGTGGAGGG - Intergenic
1048369522 8:133765571-133765593 CTTCATATGTTACATGTGGCAGG - Intergenic
1048455751 8:134576875-134576897 CTTCTTAATTAAAATGTACAGGG + Intronic
1049168573 8:141142787-141142809 CCTCTTCTGTAAAATGTAGATGG + Intronic
1049752991 8:144294476-144294498 CTTCTTGTGTCAAATAGGGAGGG - Intronic
1049967257 9:790904-790926 CCTCTTTTTTAAAATGAGGATGG - Intergenic
1050753590 9:8971630-8971652 CCTCTTTTGTAAAATTTGTATGG + Intronic
1051296493 9:15601423-15601445 CCTCTTCTGTAGAATCTGGAAGG + Intronic
1051297750 9:15614851-15614873 CTTCTTAAGTTAGATGGGGAAGG - Intronic
1051831959 9:21289301-21289323 CTCATTGTGTAAAATCTGGACGG + Intergenic
1051843032 9:21419782-21419804 TTTCCTATGTAAAGTATGGAGGG + Intronic
1052482221 9:29045892-29045914 CTTCTTGTGTCAATTGTGAATGG + Intergenic
1052610347 9:30764801-30764823 CTTATTCTTCAAAATGTGGAGGG - Intergenic
1055098138 9:72435501-72435523 TTTCATATTTTAAATGTGGAAGG - Intergenic
1055159863 9:73113236-73113258 CTTCATTTGTAAATTGTTGAAGG + Intergenic
1056222157 9:84460697-84460719 GTTCATATGTTTAATGTGGATGG + Intergenic
1056948794 9:91025352-91025374 CTTTATCTGTAAAATGTGGATGG + Intergenic
1057018496 9:91677029-91677051 CTTGTTATGTACGAAGTGGAAGG - Intronic
1058059434 9:100479142-100479164 CCTGTTGTGTAAAATGTGGATGG + Intronic
1058244438 9:102605158-102605180 CTTTTTATGGAAACTGTGAATGG - Intergenic
1058542196 9:106023100-106023122 ATTCTTCTGTAAAATGAGGTAGG - Intergenic
1058730634 9:107846641-107846663 CTACATCTGTAAAATGGGGATGG - Intergenic
1058880885 9:109285222-109285244 CTACTTACGTAAAATGAAGAGGG + Intronic
1058917962 9:109585895-109585917 ATTCTTATCTGCAATGTGGAGGG + Intergenic
1059091490 9:111364014-111364036 GTTCTTTGGTAAAATGAGGAGGG - Intronic
1060471984 9:123955792-123955814 CTTCCTCTGTAAAATGGGGCTGG - Intergenic
1060562567 9:124558636-124558658 CCTCATCTGTAAAATGTTGAGGG - Intronic
1185857799 X:3552040-3552062 GTTCATCTGTAGAATGTGGATGG - Intergenic
1185935323 X:4250018-4250040 TTTCATCTGTAAAATGGGGAGGG + Intergenic
1188567533 X:31543981-31544003 CTTCTTATCTAAATTCTTGAGGG - Intronic
1189298219 X:39934062-39934084 CTTCATCTGTAAAATGTGAAGGG + Intergenic
1189300976 X:39952082-39952104 CTTCCTCTGTAAAATGGGGCTGG - Intergenic
1190397306 X:49998162-49998184 CATCATCTGTAAAATGGGGAGGG - Intronic
1191580048 X:62750764-62750786 CTTCTTCTGGAAACTGTGAAAGG - Intergenic
1191581569 X:62767862-62767884 CTTCTTATGGAATCTGTGAAAGG - Intergenic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1193385427 X:80865450-80865472 CTTCATCTGTAAAATGTGAGGGG - Intergenic
1193558912 X:82993269-82993291 CTTTTTATGTCAACTGTGAATGG + Intergenic
1193889728 X:87030341-87030363 TTTCATATTCAAAATGTGGAAGG + Intergenic
1196293475 X:113972141-113972163 CTTCTTATCGGAAATGTGGAGGG - Intergenic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1196816430 X:119668649-119668671 CCTCATCTATAAAATGTGGAGGG + Intronic
1196889407 X:120277605-120277627 CTTCATCTGTAAAATGTGCATGG - Intronic
1197587889 X:128372126-128372148 CCTCACTTGTAAAATGTGGATGG - Intergenic
1197974020 X:132145947-132145969 CTTCGTCTCTAAAATGTGGAAGG - Intergenic
1198090572 X:133324911-133324933 ATTCTTAAGTAAAAAGTTGAGGG - Intronic
1198136077 X:133751658-133751680 TTGCTTATCCAAAATGTGGAGGG - Intronic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1199669841 X:150135212-150135234 CGTCTTTTGCAAAATTTGGAGGG - Intergenic
1200130267 X:153838983-153839005 ATTTTTGTGTAAGATGTGGAGGG + Intergenic