ID: 910658765

View in Genome Browser
Species Human (GRCh38)
Location 1:89647239-89647261
Sequence ATGCTATTATGTATCAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910658762_910658765 19 Left 910658762 1:89647197-89647219 CCTGGATTATAGGAGACAAAGCA No data
Right 910658765 1:89647239-89647261 ATGCTATTATGTATCAAACATGG No data
910658761_910658765 25 Left 910658761 1:89647191-89647213 CCATATCCTGGATTATAGGAGAC 0: 1
1: 0
2: 1
3: 3
4: 79
Right 910658765 1:89647239-89647261 ATGCTATTATGTATCAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910658765 Original CRISPR ATGCTATTATGTATCAAACA TGG Intronic
No off target data available for this crispr