ID: 910659154

View in Genome Browser
Species Human (GRCh38)
Location 1:89652237-89652259
Sequence ATTGAAAACAGGATCTATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910659151_910659154 -1 Left 910659151 1:89652215-89652237 CCATCACAGAGTGGGTTAGAGCA No data
Right 910659154 1:89652237-89652259 ATTGAAAACAGGATCTATGTGGG 0: 1
1: 0
2: 2
3: 21
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910659154 Original CRISPR ATTGAAAACAGGATCTATGT GGG Intronic
900670727 1:3852738-3852760 TTTGAAAATAGGGTCTCTGTGGG + Intronic
901415822 1:9115505-9115527 ATAGAAAACAAGACATATGTTGG + Intronic
904642755 1:31942788-31942810 CTTGAGAGCAGGAGCTATGTGGG + Intronic
905470368 1:38187300-38187322 TTTGTGAACAGGAGCTATGTTGG + Intergenic
909288352 1:73850014-73850036 CTTGAAAACAGGGGCTATTTTGG - Intergenic
910337323 1:86149242-86149264 ATTAAAATCAGAATCTCTGTGGG - Intronic
910347324 1:86255076-86255098 ATTGAAAACAGTATCTACCTAGG - Intergenic
910659154 1:89652237-89652259 ATTGAAAACAGGATCTATGTGGG + Intronic
910718544 1:90258890-90258912 ATTTAAAACAGGATCTTTGGAGG - Intergenic
911098383 1:94074503-94074525 ATTGAAAAATGGATCTAATTAGG + Intronic
911876313 1:103167885-103167907 AGAGAGAACAGGATCTATATTGG + Intergenic
913107866 1:115631214-115631236 AGTGTAAACAGTATCTAAGTGGG + Intergenic
916270427 1:162935340-162935362 AGAGATAACAGTATCTATGTTGG + Intergenic
919166594 1:193903206-193903228 ATTGAAAATAGCATCTAAGTGGG + Intergenic
921471904 1:215559748-215559770 ACTCAAAATAGGATCTATCTTGG + Intergenic
921759060 1:218891031-218891053 ATTGAAGAAAGGTTCAATGTAGG - Intergenic
922065038 1:222128697-222128719 ATTGTAAACAGAATCTATAATGG - Intergenic
1063466761 10:6250988-6251010 AATTAAAACAGAATCTCTGTGGG - Intergenic
1063956330 10:11270939-11270961 ATTGAAATCAGCATTTATGCAGG + Intronic
1064550164 10:16492478-16492500 ATGGCAAAAAGGATATATGTGGG - Intronic
1066590371 10:36987987-36988009 ATTGAGAACAGGAGCTATCCAGG + Intergenic
1066610323 10:37239309-37239331 ATTGAAAAAAGGATAAATATAGG - Intronic
1066612241 10:37261503-37261525 CTTGAAAAAAGGTTCAATGTTGG + Intronic
1071320278 10:84448375-84448397 AGTGAAAACAGTATCCATGAGGG - Intronic
1077431099 11:2516391-2516413 TTTAAAAACAGGCTCTATGGTGG - Intronic
1079724258 11:23860946-23860968 AATGAAAACAGCATCCATGGAGG - Intergenic
1079745841 11:24128944-24128966 TTTGAAAACAGGATCTTTGGAGG - Intergenic
1079808565 11:24964356-24964378 TTAGATAACAGGATGTATGTGGG + Intronic
1079877379 11:25876896-25876918 GCAGAAAACAGGAGCTATGTGGG - Intergenic
1080113024 11:28590702-28590724 TTTGAACACAGGATTTATGAGGG + Intergenic
1080545943 11:33318616-33318638 ATTTTAAAAAGGATTTATGTAGG + Intronic
1080975668 11:37337332-37337354 ATTCAAGAAATGATCTATGTTGG + Intergenic
1081164102 11:39786617-39786639 CTTGAAAAGAGGCTCTGTGTGGG - Intergenic
1082921542 11:58500217-58500239 ATTGAATATAGGAGCTCTGTTGG + Intergenic
1083014068 11:59433647-59433669 ATTGAATATAGGATCTATTTTGG - Intergenic
1083161431 11:60856661-60856683 ATTTAAAACAGGCTCAATTTTGG + Intergenic
1083336140 11:61922935-61922957 ATGGAAAACAGGATATGTGAAGG + Intergenic
1084531959 11:69732645-69732667 ATTGAAAACCGGGTCTCTGTGGG + Intergenic
1087382659 11:97426517-97426539 ATTGAAAACAGAATTCATGATGG + Intergenic
1088270146 11:108026096-108026118 ATTGAGAAGAGAATTTATGTTGG - Intronic
1091393649 12:140810-140832 ATTGACAACAGGATATGGGTAGG + Intronic
1092773467 12:11919558-11919580 ATTGAAAATAGGATACATTTGGG - Intergenic
1095193135 12:39281785-39281807 ATTGAAAACAGGATATCAATAGG + Intergenic
1095254974 12:40023853-40023875 AATGAAAACTGGAACTATTTAGG + Intronic
1095419800 12:42013154-42013176 ATTTAAAAAAGGCTTTATGTTGG - Intergenic
1096887672 12:54733880-54733902 ATTGAAAACAGGAATGATGCTGG + Intergenic
1099936710 12:89134660-89134682 AATGAGAACAGGATCCATTTAGG - Intergenic
1100847661 12:98677469-98677491 ATGGTAAACAGCATCTGTGTGGG - Exonic
1100873125 12:98933472-98933494 ATTGAAATCAGGATCTAAAGAGG - Intronic
1101497460 12:105268380-105268402 AATGTAAACAGGATCTAGATTGG + Intronic
1103779026 12:123387376-123387398 ATGGATAAGATGATCTATGTGGG + Intronic
1108084516 13:46772100-46772122 ATTGTTAACAGGATTTATGATGG - Intronic
1109626084 13:64976818-64976840 AATAAAAACAGCATATATGTGGG + Intergenic
1109634863 13:65102057-65102079 GTTAAAAACAGGATAAATGTTGG - Intergenic
1109639533 13:65171460-65171482 ATTGAAACCATGATCTCTTTGGG - Intergenic
1109783219 13:67140602-67140624 AATTAAATCAGGATCTTTGTGGG - Intronic
1112866557 13:103907946-103907968 ATTTAAAACAGGAACGAAGTAGG + Intergenic
1113393834 13:109924507-109924529 TTTGAAAACAGTAATTATGTGGG + Intergenic
1115384333 14:32778259-32778281 ACTGAAAATAGTAACTATGTGGG + Intronic
1116144400 14:41045243-41045265 ATTTAAAACATAATTTATGTCGG + Intergenic
1118366897 14:65103392-65103414 ATTGCAAAAAGGATCAATATGGG + Intergenic
1120502561 14:85314735-85314757 AAAGAAAACAAGATCTATTTAGG + Intergenic
1121656886 14:95603671-95603693 ATTGATTACAGAATCTAAGTGGG + Intergenic
1121706533 14:96000094-96000116 ATAGAAAAAAGGATCCAGGTAGG - Intergenic
1121744344 14:96276357-96276379 ATTGAAAATAGCATAGATGTTGG + Exonic
1123046338 14:105518326-105518348 TTTGGAAATAGGATCTTTGTAGG - Intergenic
1124835924 15:33195798-33195820 TTTGAAAACAGAATCTATTCAGG - Intergenic
1127027126 15:54819286-54819308 AATAAAAACAGCATCTTTGTTGG + Intergenic
1129480743 15:75823623-75823645 AATGATAACAGTATCTATTTGGG + Intergenic
1129625852 15:77198630-77198652 ATTGAAAACAGCATTTGTATGGG + Intronic
1132948783 16:2548385-2548407 ATTGAAAACATCAACTATTTTGG + Intronic
1132965804 16:2653742-2653764 ATTGAAAACATCAACTATTTTGG - Intergenic
1133663022 16:7937269-7937291 ATTTAAAACAGCATCTGAGTAGG + Intergenic
1138999537 16:62492670-62492692 ATTGAAAACAGGAACAATTTGGG + Intergenic
1139093424 16:63676521-63676543 ATTGATGACACGTTCTATGTGGG + Intergenic
1141585821 16:85032928-85032950 ATTGAAAATAGGGTCTCTGTGGG - Intronic
1145233066 17:21189083-21189105 ATTCAGAACAGGACCTCTGTGGG + Intronic
1148377878 17:47165955-47165977 ATTAAAAACAGGATCTTGGATGG - Intronic
1150910406 17:69381757-69381779 ATTGGAAATAGGATCTTTGTAGG - Intergenic
1152712551 17:81880546-81880568 AGGGAAAACAGTAACTATGTAGG + Intergenic
1153472477 18:5462602-5462624 ATGGAAAACAGGTTCGGTGTGGG + Intronic
1155917787 18:31573014-31573036 AGTGAAAACAGTCTCTAGGTGGG + Intergenic
1156243967 18:35279856-35279878 CTTGAAAATAGGGTCTGTGTAGG - Intronic
1159251851 18:65889633-65889655 AATGAAAAGATGATCTATGATGG + Exonic
1160664442 19:317905-317927 ATTAAAAATAAGATCTAGGTCGG + Intronic
926228930 2:10988190-10988212 TTTGGAAACAGGATCTTTGGAGG - Intergenic
926678083 2:15643181-15643203 ATTGAAAAGAAGATCTTTCTAGG + Intergenic
926879027 2:17520279-17520301 ATTGAAACCACTATTTATGTGGG + Intergenic
927002105 2:18807296-18807318 ATTGAAAGCACGATCTGTCTTGG - Intergenic
927412602 2:22844256-22844278 TTTGAAAACAAGAACAATGTTGG + Intergenic
927528861 2:23774991-23775013 ATTGAGAACAGGATCTGTATAGG - Intronic
928986301 2:37185751-37185773 ATTGAAATCTGGATAAATGTTGG + Intronic
930294342 2:49535978-49536000 ATTGAAATCAGGATCTGGGGTGG + Intergenic
931022258 2:58060838-58060860 TTTGAAAATAGGATTTATGATGG + Intronic
932520079 2:72403026-72403048 ATTGCAAATTGGATCTCTGTTGG + Intronic
932862174 2:75305503-75305525 GTTGGAAACAGGATCTAGTTTGG + Intergenic
932910840 2:75804755-75804777 AGTGAAAACAGAAATTATGTAGG - Intergenic
934050821 2:88209260-88209282 ATTAAAAACAAGCTGTATGTAGG - Intergenic
934803903 2:97198596-97198618 ATTCAAAACAGAATCTTTCTCGG - Exonic
934804595 2:97207944-97207966 ATTCAAAACAGAATCTTTCTCGG - Exonic
934876521 2:97925510-97925532 ATAGAAAACATAATCTATGGGGG + Intronic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
939031661 2:137083642-137083664 ATTCAAAAGAGAATCTATCTGGG - Intronic
939587457 2:144022449-144022471 ATTGAAAATAGGAAAGATGTTGG - Intronic
941859574 2:170264761-170264783 ATTGGAAAGAGGATATTTGTTGG + Intronic
942985873 2:182141236-182141258 ATTTAAAATAGAATCTATCTGGG - Exonic
943014173 2:182491093-182491115 TTTTAAAACAGCAACTATGTTGG + Intronic
943327944 2:186524181-186524203 ATAGAAAAGAGGATGAATGTAGG - Intergenic
945650262 2:212549853-212549875 CTTGATAACAGGTTGTATGTGGG + Intergenic
946816911 2:223588191-223588213 ATAGAAAACAGGGTGAATGTAGG + Intergenic
1169081988 20:2803069-2803091 ATTGCCAATAGGTTCTATGTTGG - Intergenic
1170394632 20:15912712-15912734 ATTGCAAAGAGGATGTTTGTTGG + Intronic
1173397988 20:42698610-42698632 AATGAAATCAGAATCTATGCGGG + Intronic
1174061682 20:47837473-47837495 ATTAAAAACAGGAACAAAGTTGG + Intergenic
1174069826 20:47891751-47891773 ATTAAAAACAGGAACAAAGTTGG - Intergenic
1174321416 20:49744628-49744650 ATTGATAACAGCAATTATGTTGG - Intergenic
1177006815 21:15683653-15683675 CCTGAAAACAGGATCTGTGTTGG - Intergenic
1181725542 22:24808408-24808430 ATTGAAAAGAGGTTCTAGGCTGG - Intronic
1182571502 22:31242520-31242542 ATTGAAAAAAGAAAATATGTTGG - Intronic
1182885000 22:33765905-33765927 TTTTAAAACAGAATCTATGGTGG + Intronic
1183202916 22:36398308-36398330 ATTGAAATAAGAATCTATGTGGG + Intergenic
1183835617 22:40450410-40450432 ATTGAAAACAGCATCAAAGCAGG - Intronic
950975147 3:17233571-17233593 ATTGAAAACAGTATGAATGGAGG + Intronic
951808363 3:26671931-26671953 TTTGAACACAAGATCTATTTAGG + Intronic
953802365 3:46034944-46034966 AAAGAAAACAGGAACTATGGAGG - Intergenic
954940231 3:54365502-54365524 AGTGAAAATAGGATGAATGTAGG - Intronic
955761888 3:62294288-62294310 AAAGAAAACAGTAACTATGTAGG - Exonic
956880769 3:73508656-73508678 ATTAAAAACAGGATTTACCTGGG - Intronic
957570336 3:81939379-81939401 ATAGAAGACAGAATGTATGTGGG - Intergenic
959497574 3:107069149-107069171 ATTGAAGACGGGATGTGTGTGGG - Intergenic
961170981 3:124797577-124797599 CTTGAAAACAGGCTCAAGGTGGG + Intronic
961811323 3:129523430-129523452 CTTGAAAGCAGGAACCATGTGGG + Intergenic
963030856 3:140974282-140974304 TTTGAAAAAAGTATGTATGTAGG + Intronic
964991623 3:162819653-162819675 ATTGAAAACTGCAGCTGTGTGGG - Intergenic
966217971 3:177521854-177521876 ATTGAAAGAAGGATCTAGGAGGG + Intergenic
967164012 3:186764424-186764446 ATTGAAAACAAGATCTAGCTGGG + Intergenic
969172309 4:5373955-5373977 ATTGAAAATAGGATCTTTGCCGG + Intronic
970176485 4:13344854-13344876 ATTGAAAACAGGAGGTGTTTCGG - Intergenic
970667639 4:18355616-18355638 ATTGATAACAGGATAAATCTTGG - Intergenic
972116727 4:35645039-35645061 TTTCAAAAAAGGATATATGTGGG + Intergenic
972995623 4:44875523-44875545 ATTGAAAACAAGATTTATATTGG - Intergenic
973024574 4:45251349-45251371 ATGGAAAACAGGAAATATGGTGG - Intergenic
973227612 4:47803556-47803578 ATTGAAAATGAGGTCTATGTAGG - Intronic
974737988 4:65964341-65964363 ATTGGAAACATGATCACTGTTGG - Intergenic
974976402 4:68898562-68898584 ATTGCAAAGAAGATCTATTTTGG + Intergenic
974989747 4:69071970-69071992 ATTGCAAAGAAGATCTATTTTGG - Intronic
975474415 4:74806675-74806697 AATGAAAACATCATCTATGAGGG + Intergenic
976073457 4:81270266-81270288 TTTGCAAACATCATCTATGTTGG + Intergenic
977165572 4:93692075-93692097 TTTGAATACATGTTCTATGTAGG - Intronic
978462602 4:108973540-108973562 GTTGAAAAAAGAAACTATGTAGG - Intronic
979049141 4:115908329-115908351 ATTAAAAACGGCATCTCTGTGGG - Intergenic
979753296 4:124306378-124306400 AGTGAATACAGGATGCATGTTGG + Intergenic
979943056 4:126787227-126787249 ATAGAAAACAATATCTATCTAGG + Intergenic
982339592 4:154282690-154282712 ATTGAAAACAGGATCTCAAAGGG + Intronic
983050677 4:163043588-163043610 ACTGAAAACAGAATTTGTGTTGG - Intergenic
984197942 4:176682186-176682208 ATTGAAAACAGGATATTTTCAGG + Intergenic
990802512 5:59620671-59620693 AGTGAAATCAGGATCTTTGTGGG + Intronic
991546482 5:67787581-67787603 ATTGAAAACATTACCTATCTAGG + Intergenic
994079537 5:95691759-95691781 ATTGAAAACAGGAACAACATAGG - Intronic
994646445 5:102475101-102475123 ATTGACAACAGGATCTCTGTGGG + Intronic
995729310 5:115220473-115220495 AATGTATACAGGATTTATGTTGG + Intronic
995750564 5:115449486-115449508 CTTGGAAACAGGGTCAATGTTGG - Intergenic
995786143 5:115830488-115830510 TTTCAAAACAGGATCTAAGATGG - Exonic
996175886 5:120356613-120356635 ATTGAAAACATGATTTAGATAGG + Intergenic
997482267 5:134194981-134195003 ATTTAAATCAGAATCTCTGTAGG + Exonic
997780709 5:136655131-136655153 ATTGGAATAAGGATCAATGTAGG + Intergenic
999952725 5:156667602-156667624 ATTGTGAACAGCATCCATGTTGG + Intronic
1000716800 5:164653893-164653915 CTTGCAAACAGCATCTATGGTGG - Intergenic
1002446013 5:179290515-179290537 ACTGAAACCAGGAACTTTGTAGG - Intronic
1003017042 6:2476447-2476469 ATTTAAAACATGATTTATTTTGG + Intergenic
1003192472 6:3886708-3886730 ATTTAAAACAGTATGCATGTAGG - Intergenic
1004114715 6:12755060-12755082 CTTGAACACAGAATCTATGTTGG + Intronic
1004274634 6:14224841-14224863 ACTTAAAATAGGACCTATGTAGG + Intergenic
1004568567 6:16822835-16822857 AAATAAAACATGATCTATGTAGG - Intergenic
1005229089 6:23679380-23679402 TTTGAAAATAGTATCTATTTAGG - Intergenic
1005357335 6:24997158-24997180 AATGAAATCAGAATCTCTGTTGG + Intronic
1006046234 6:31301111-31301133 CTTGAAAGCAGTATCTATGGTGG + Intronic
1006311071 6:33260701-33260723 ATTAAAAACAGAATCTAGGCCGG + Intronic
1008473406 6:51909759-51909781 ATTGAAATAAGCATCTATTTAGG - Intronic
1009942920 6:70309797-70309819 GTTGAAAACATGACCTATATGGG - Intergenic
1010814413 6:80340235-80340257 ATTGCCAACAGAATATATGTAGG + Intronic
1011401421 6:86966156-86966178 AATGAATACAGGATCTGGGTGGG + Intronic
1012549904 6:100456599-100456621 AAGGAAAACAGAATCTATTTTGG + Intronic
1012880895 6:104787708-104787730 TTTGAAAATAGGATCACTGTTGG - Intronic
1014845912 6:126276836-126276858 AATGAAAATAGAATCTATGTAGG - Intergenic
1016647901 6:146431394-146431416 ATTGTCCACAGGTTCTATGTGGG - Intronic
1017272462 6:152524304-152524326 ATTAAAAACAAAATCTATATGGG - Intronic
1018546579 6:164943236-164943258 ATTGTGAACAAGATCTATGTGGG + Intergenic
1020110539 7:5445545-5445567 TTTGGAAACAGGATCTTTGCAGG + Intronic
1021211523 7:17859973-17859995 ATTGAAAACAGGATCTTAAAGGG - Intronic
1021255544 7:18388059-18388081 ATTATACATAGGATCTATGTGGG + Intronic
1021592824 7:22282544-22282566 ATTAAAAATAATATCTATGTGGG - Intronic
1022296757 7:29062890-29062912 ATTCAAAACAGGATATAGGGAGG + Intronic
1022319838 7:29278227-29278249 ATTGAAATCAGAATCTCTGGTGG - Intronic
1023315911 7:38936198-38936220 ATTGAGAGCAGGATCTAGCTGGG - Intergenic
1023525309 7:41096392-41096414 ATTCAAAAGAGTGTCTATGTAGG - Intergenic
1024767660 7:52679693-52679715 AGTGAAAAGAGGCTCTATATGGG - Intergenic
1026143350 7:67724696-67724718 ATTGTTAACAGGATCCATTTAGG + Intergenic
1026622679 7:71963964-71963986 ATTGAAAACAAGACATATTTTGG - Intronic
1026731145 7:72912774-72912796 TTTCAAAACAAGATCTAAGTGGG + Intronic
1027846416 7:83382511-83382533 ATTGCAAACAGGAACTGAGTAGG - Intronic
1027915129 7:84308456-84308478 ATGGAAAACAAGTTCTTTGTGGG + Intronic
1027958364 7:84911584-84911606 TTTGAAGACAGGACCTATATAGG - Intergenic
1028072661 7:86471002-86471024 ATTGAAAAAAGAATCTAAGCTGG - Intergenic
1031575754 7:123414131-123414153 TATGAACACTGGATCTATGTGGG - Intergenic
1032116415 7:129121472-129121494 ACTGAAGACAGGGCCTATGTAGG - Intergenic
1032661924 7:133993554-133993576 GTTGAAAACAGGATTTAACTTGG + Intronic
1034648451 7:152669779-152669801 GTTGAAAACAGCAACTGTGTTGG - Intronic
1041179634 8:55234136-55234158 ATTGAAAGCTGCATCTCTGTGGG - Intronic
1043223140 8:77691976-77691998 ATTGAAAACAGGAAATCTATAGG + Intergenic
1043240197 8:77923762-77923784 AATAAAAACAGAATCAATGTTGG + Intergenic
1043367257 8:79547655-79547677 ATTGTAAAAAGCAGCTATGTAGG + Intergenic
1043517636 8:81010257-81010279 ATTCAAAACATGATCTGTTTTGG - Intronic
1043869338 8:85414229-85414251 ATTGAAAACAGGATCATGGAGGG - Intronic
1044106417 8:88212698-88212720 GTAGAAAACAGGATTTATGGTGG - Intronic
1045006042 8:97917646-97917668 ATTCAAAGCAGGGTGTATGTGGG + Intronic
1046076452 8:109318073-109318095 ATTGAAAACCTGCTCTGTGTAGG - Intronic
1046188294 8:110752470-110752492 TCTGAAATCAGGCTCTATGTTGG - Intergenic
1046552332 8:115732371-115732393 ATTCAAAACAGGAGCAATATAGG - Intronic
1047439436 8:124863791-124863813 CTTGTAAACAGGTTCTATCTTGG + Intergenic
1047574961 8:126142842-126142864 GTTGAAAACAGAAACTATGCAGG + Intergenic
1050126146 9:2358101-2358123 AGGGACAACAGGGTCTATGTGGG + Intergenic
1050272203 9:3958347-3958369 TTTGAAAAAAGAATCGATGTAGG - Intronic
1050423277 9:5489214-5489236 ATTAAAAGTAGGATGTATGTGGG - Intergenic
1052748786 9:32467716-32467738 AGTCAAAACAGAATCCATGTAGG + Intronic
1055114393 9:72591346-72591368 AATTAAATCAGGATCTCTGTGGG - Intronic
1057996141 9:99822835-99822857 ATTGAAAATAGGAGCTCTGGTGG + Intronic
1058172781 9:101702941-101702963 ATTGAATTCAGGATATATTTTGG - Intronic
1058555384 9:106161202-106161224 AATGAAAACAAAATCTCTGTTGG - Intergenic
1058772545 9:108250058-108250080 ATTAAAAACTGGATGTATGGTGG + Intergenic
1059816901 9:117926821-117926843 ATTTAAAACAATACCTATGTGGG - Intergenic
1059970496 9:119662863-119662885 ATTGAAAACAGGGTCTATGAGGG - Intergenic
1060418170 9:123447650-123447672 TTTGAAAATTGGATCTTTGTTGG + Intronic
1186209886 X:7239269-7239291 ATTTAAAACAGGACCTTTGTTGG + Intronic
1187745607 X:22405912-22405934 ATTGAAAAAAGCATGAATGTTGG - Intergenic
1187907236 X:24078426-24078448 ATTAAAATCAGAATCTCTGTGGG - Intergenic
1189454337 X:41171350-41171372 AATGAAAACAAGAACTATGTAGG + Intronic
1189678155 X:43485610-43485632 ATTGGAAATATGATCTATCTTGG - Intergenic
1193285671 X:79712431-79712453 ATTGAAAACAAGATCTTTTGAGG + Intergenic
1194891668 X:99386205-99386227 ATTAGAAACAGGATCTAAGGGGG - Intergenic
1196412061 X:115430806-115430828 AGTGAAAGTAGCATCTATGTTGG - Intergenic
1200663046 Y:5984940-5984962 ATTCAAAACATGTCCTATGTAGG + Intergenic
1201547314 Y:15179913-15179935 AATGAAAACAGGCTCTATAGGGG - Intergenic
1202254594 Y:22908054-22908076 CCTGAAAACAGGATATGTGTGGG + Intergenic
1202407585 Y:24541803-24541825 CCTGAAAACAGGATATGTGTGGG + Intergenic
1202463196 Y:25128278-25128300 CCTGAAAACAGGATATGTGTGGG - Intergenic