ID: 910662868

View in Genome Browser
Species Human (GRCh38)
Location 1:89692458-89692480
Sequence CTACTCAGCTTGGAAAATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910662865_910662868 8 Left 910662865 1:89692427-89692449 CCTAAAAGATTGTATTCATATAG No data
Right 910662868 1:89692458-89692480 CTACTCAGCTTGGAAAATACTGG 0: 1
1: 0
2: 1
3: 11
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910662868 Original CRISPR CTACTCAGCTTGGAAAATAC TGG Intronic
902733008 1:18382288-18382310 GTTATCAGCTTGCAAAATACAGG - Intergenic
903164780 1:21512540-21512562 CTACACAGCAGGGAAAACACTGG + Intronic
904471116 1:30736940-30736962 TTATTCAGCATGGAAAATAGAGG - Intronic
904504477 1:30939475-30939497 CTGCCCAGCATGGAAAAGACTGG + Intronic
908233141 1:62125496-62125518 CTACTCTGGTGGAAAAATACCGG - Intronic
910660699 1:89669100-89669122 CTACTCAGCCTTTAAAAAACAGG + Intronic
910662868 1:89692458-89692480 CTACTCAGCTTGGAAAATACTGG + Intronic
911837276 1:102636440-102636462 CTACTCAACATGGTAAATGCAGG + Intergenic
912154724 1:106903828-106903850 CTTCTTAGCTTGGAACATCCAGG - Intergenic
913251507 1:116915502-116915524 TTAATCAGCTTGGCAGATACAGG - Intronic
916070789 1:161168514-161168536 TTGCTCAGCTTGGAAGAGACTGG - Exonic
919932870 1:202232889-202232911 CTCCTCATCTTGGAAAACAAAGG + Intronic
1063326450 10:5108163-5108185 CATCTCTGCTTGGAAAATATTGG + Intronic
1064383666 10:14870292-14870314 CTATTAATCTTGGAAAATAAAGG - Intronic
1067696062 10:48536407-48536429 CAACTCAGCCCGGAAAATAGTGG - Intronic
1068175054 10:53447229-53447251 CTTCTCACATTGCAAAATACAGG + Intergenic
1069296415 10:66850660-66850682 CTACCCAGCTTGAAAAAAAATGG - Intronic
1072074122 10:91951223-91951245 CTAATCACATTGGAAAATACTGG - Intronic
1077256507 11:1586069-1586091 CTACTCAACTTGGGAAAAAATGG + Intergenic
1077833266 11:5899219-5899241 GTTCTCAGCTTGAAGAATACTGG + Intronic
1078108869 11:8375971-8375993 AAACTCAGCTTGGAGAATACAGG + Intergenic
1080136834 11:28864961-28864983 CTTCTTAGCTAGGAAGATACTGG - Intergenic
1080319348 11:30988405-30988427 CTATTCAGCTTGAAAAAAAATGG + Intronic
1080619704 11:33977158-33977180 CTACTCTGCATGGATCATACAGG - Intergenic
1080721794 11:34856364-34856386 CTATTTAGCTTGGAGAATATGGG - Intronic
1080732336 11:34970634-34970656 ATACTGAGCTTTAAAAATACAGG + Intronic
1081025438 11:38007413-38007435 CTAATATGTTTGGAAAATACTGG - Intergenic
1081221332 11:40466463-40466485 ATACTATGCTTGGAAAATAAAGG + Intronic
1086975569 11:93128823-93128845 CTACCCAGCTTGGAAACCATAGG + Intergenic
1088508144 11:110546603-110546625 TTTCTCAGCTTGGACAATATTGG - Intergenic
1088804078 11:113335109-113335131 CTAATCAGCTTGGAGAATCATGG - Intronic
1096422866 12:51475188-51475210 CTACTCTGGTTGGGAAATAACGG - Exonic
1097719788 12:63008119-63008141 CAACTAAGCTTAGAAAACACAGG - Intergenic
1097781883 12:63716312-63716334 ATACTCAACATGGAAAATACTGG + Intergenic
1100023158 12:90096238-90096260 CTACACAGCTAGGAAAAGGCTGG + Intergenic
1100330418 12:93576495-93576517 CTACTCAACTTGTAAAAGACTGG - Exonic
1105538429 13:21292417-21292439 CTGCTCATCTTAGAAAATAAGGG - Intergenic
1105714531 13:23049061-23049083 GTACTCAGCTTGGACATTATTGG - Intergenic
1106252971 13:27997081-27997103 CTACTCAGCCTTTAAAAAACAGG + Intergenic
1107820978 13:44285404-44285426 CTCCTCAGCTAGGAAAAGGCAGG - Intergenic
1108150276 13:47526532-47526554 CTACCTAGCATGGAAAACACAGG - Intergenic
1108350555 13:49586917-49586939 CTACTCATCTTTCAAAATCCAGG + Intergenic
1111832878 13:93352450-93352472 CTATTTAGCTTGGTAAATTCTGG + Intronic
1113549186 13:111178690-111178712 CCACCCAGCTTGGAAAAGGCAGG + Intronic
1115617286 14:35107823-35107845 CAACTCAACTTGTAATATACTGG + Intronic
1117207697 14:53461278-53461300 CTCCTCAGCTTGGCAGATATAGG + Intergenic
1118275083 14:64379289-64379311 CTACTCATGTTGGACAATTCAGG - Intergenic
1125300665 15:38251813-38251835 TTACTCTGCTTGGAATATCCGGG - Intergenic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1129168267 15:73791707-73791729 CCACTCAGCCTGGAAGATGCAGG - Intergenic
1131184285 15:90262062-90262084 ATTCTCACCTGGGAAAATACCGG + Exonic
1131457882 15:92597425-92597447 CTATGCATCTTGGAAATTACAGG + Intergenic
1131600567 15:93844645-93844667 CTGCTGAGGTAGGAAAATACTGG - Intergenic
1135669676 16:24364499-24364521 TGACTGAGCTTGGAAAATGCTGG - Intergenic
1137910852 16:52376586-52376608 CAACTAACTTTGGAAAATACTGG - Intergenic
1138154485 16:54690391-54690413 CTATTCAGCTGGGACCATACTGG + Intergenic
1142909001 17:3071327-3071349 TTACTCAGCTTGTAAAAGAATGG + Intergenic
1142925561 17:3232915-3232937 TTACTCAGCTTGTAAAAGAATGG - Intergenic
1144154854 17:12489824-12489846 CTACTCAGTATGCCAAATACTGG + Intergenic
1145209286 17:21001309-21001331 CTGCTCAGTGTGGAAAACACAGG - Exonic
1146264714 17:31444724-31444746 CTGCTCAGCTTTAAAAAGACGGG - Intronic
1146629879 17:34462280-34462302 CCACACAGTTTGGAAAATATTGG - Intergenic
1146715248 17:35080685-35080707 CTACTCATCTTGAAACTTACAGG - Intronic
1148229823 17:45924893-45924915 CCAAGCAGCTTGGAAGATACAGG - Intronic
1148398141 17:47326772-47326794 ATACTCATCTCAGAAAATACTGG - Intronic
1151081825 17:71338097-71338119 CTATTCAGCATGGAAAATTAGGG + Intergenic
1152601484 17:81264451-81264473 CACCTGAGCTTGGAAAATCCAGG + Intronic
1153774623 18:8441669-8441691 CTAGTCAGTTAGGAAAATTCTGG - Intergenic
1155702007 18:28757525-28757547 CTTCCCAACTTGGGAAATACTGG - Intergenic
1155708661 18:28847862-28847884 CTACTCAGCTTGGAGGCTGCAGG - Intergenic
1159520873 18:69521318-69521340 CTCCTCAACTTTTAAAATACAGG - Intronic
1160332030 18:78002820-78002842 CTACTTATCTTAGAAAATAATGG + Intergenic
928800922 2:35090688-35090710 CTACTCAGCCATGAAAATAAGGG + Intergenic
930577382 2:53167611-53167633 CCACTCAGCTTGGCAAGTTCAGG - Intergenic
931476953 2:62597883-62597905 CTACTCACCTTGCACAGTACTGG - Intergenic
931715895 2:65028345-65028367 CTGGGCAGCTTTGAAAATACTGG - Intergenic
932030863 2:68183131-68183153 CTTCTCATTTTGGAAACTACTGG - Intronic
933073762 2:77896036-77896058 CTACTCATCTTGCAAACTGCAGG + Intergenic
935750950 2:106233267-106233289 CACCACAGCTTGGAAAATGCTGG - Intergenic
935836933 2:107064907-107064929 CTACTGAGCTTGGGAAAGAATGG - Intergenic
939648812 2:144736788-144736810 CTAATGAGTTTGGAAAAGACAGG + Intergenic
940586815 2:155662248-155662270 CTATTCAGCTTTGAAAATGAAGG + Intergenic
941390213 2:164903876-164903898 CTATTCAGGTAGGAAAATTCAGG - Intronic
944450667 2:199838901-199838923 CAACTCAGCTTCTAAAACACTGG + Intronic
946630407 2:221661459-221661481 CAACTCAGGCTGGAAACTACTGG + Intergenic
1169920480 20:10729927-10729949 ATTTTCAGCTGGGAAAATACAGG - Intergenic
1170758371 20:19225428-19225450 CCACAATGCTTGGAAAATACCGG - Intronic
1177697535 21:24592667-24592689 CTAATCAGCTTGCTAAAGACTGG + Intergenic
1177803618 21:25852673-25852695 ATACTAAGCGTGGAAAATAGGGG - Intergenic
1177809687 21:25912643-25912665 CTGCTCACATTGGGAAATACGGG - Intronic
1182530212 22:30949766-30949788 CTACTCAGATTGGGCAGTACGGG - Exonic
1182750190 22:32635355-32635377 CTACTGAGCTTCCCAAATACAGG - Intronic
950053003 3:10006185-10006207 CTTCTCAGCTTGGACGATGCTGG - Intronic
950304642 3:11908462-11908484 CTGCCCAGCTTGGAAGACACTGG - Intergenic
952703196 3:36348298-36348320 CTGCTCAGTTGGGAAAATATGGG - Intergenic
955391034 3:58522420-58522442 CTACCCTGCTGGGAAAATCCGGG - Intronic
956144498 3:66178472-66178494 CTACTGAGCTTGGACAACAAGGG - Intronic
960308140 3:116087659-116087681 TTACTTGGCTTAGAAAATACAGG - Intronic
962933952 3:140062166-140062188 GTACTCAGTTTGCAAACTACTGG + Intronic
964157213 3:153600612-153600634 CTACTCAGCCTGGTAAATACTGG + Intergenic
967762017 3:193236834-193236856 ATAATCAGTTTGGAAAAAACTGG + Intergenic
969146496 4:5128627-5128649 CAGCTCAGCTTAGCAAATACTGG + Intronic
970323556 4:14899587-14899609 AAAGTCAGCTTAGAAAATACAGG + Intergenic
970464678 4:16310680-16310702 CAACTGAGATTGGAAAAGACTGG + Intergenic
972974008 4:44611159-44611181 CTACTCAGCGTGCCAAGTACAGG + Intergenic
975113457 4:70652348-70652370 CTACTGAGGCTGGAAATTACAGG - Intronic
978396649 4:108287541-108287563 CTACTAATCTTGGAAATTAAGGG + Intergenic
979443332 4:120779534-120779556 TTACTCAGCATTAAAAATACAGG + Intronic
982109302 4:152039212-152039234 GTCCTCATCTAGGAAAATACAGG + Intergenic
983294954 4:165855220-165855242 TTAATCAGCTTGGAAAAAAATGG - Intergenic
987598133 5:20028370-20028392 TTACACAGATTAGAAAATACTGG - Intronic
987911900 5:24157777-24157799 CTCTTCAGCTTTAAAAATACTGG - Intronic
988685988 5:33526176-33526198 CTTCTCAGGTTGGAAAATGGAGG - Exonic
989950449 5:50291849-50291871 CTATTCAGCTGGGAATTTACTGG - Intergenic
991291545 5:65037737-65037759 ATACTCAGCATGGAGAAAACTGG - Intergenic
993257390 5:85609252-85609274 CTACTCATCTTGAAAAGTATAGG + Intergenic
999280370 5:150361258-150361280 CAACTCAGCTTGGAATAAGCTGG + Intronic
999600874 5:153263950-153263972 CCACTGAGGCTGGAAAATACAGG - Intergenic
1000970518 5:167709206-167709228 GAACTCAGCTTGGAAAAGACAGG - Intronic
1006226042 6:32537161-32537183 CTATCCAGCTAGGAAAAGACAGG - Intergenic
1007083628 6:39127163-39127185 CTACTGAGCTTGGACTATGCCGG - Intergenic
1012370224 6:98496265-98496287 GCAGTAAGCTTGGAAAATACAGG - Intergenic
1013384704 6:109614720-109614742 ATACTTAACTTGGAAAATGCTGG + Intronic
1017097014 6:150813429-150813451 CTCAGCAGCTTGGAAACTACTGG + Intronic
1022940487 7:35232419-35232441 ATACTCAACATGGAAAATACTGG + Intronic
1026262739 7:68769819-68769841 CCACTCATCTTGGAAAAGAAGGG - Intergenic
1028320378 7:89452131-89452153 CTACTCATCTTTGAAGAAACAGG - Intergenic
1033223116 7:139541929-139541951 AACCTCAGCTTGGAAGATACTGG - Intronic
1034295138 7:149965782-149965804 CTAATAAGTTTGGAAAATTCTGG - Intergenic
1034810922 7:154131165-154131187 CTAATAAGTTTGGAAAATTCTGG + Intronic
1036289433 8:7474303-7474325 CTGCTCAGCTTGTAAAAGAAGGG + Intronic
1036332044 8:7837229-7837251 CTGCTCAGCTTGTAAAAGAAGGG - Intronic
1044031492 8:87243110-87243132 ATCCTCAGCTTGAATAATACAGG - Intronic
1047359964 8:124160179-124160201 CTATTCAGCTTGCAAAAGATGGG + Intergenic
1047803903 8:128338761-128338783 GTCCCCAGCTTGGAAATTACTGG + Intergenic
1047822700 8:128538945-128538967 CTACTCACATTAGAAAATAACGG - Intergenic
1049081356 8:140445635-140445657 CTGTCCAGCTTGGAAAATGCAGG - Intronic
1050447989 9:5747052-5747074 CTACTCACCTTTGAGAACACTGG + Intronic
1054443698 9:65290757-65290779 CACCTCACCTTGGAAAATAGAGG + Intergenic
1054486576 9:65730746-65730768 CACCTCACCTTGGAAAATAGAGG - Intronic
1056494064 9:87138585-87138607 CTACTAAGATTGCAAAATCCAGG - Intergenic
1057871885 9:98724335-98724357 ATACTCAGCCTGGGAAACACAGG - Intergenic
1060730766 9:126035538-126035560 ATACCCAGCTTGGGAAGTACAGG + Intergenic
1061731829 9:132620963-132620985 CTACTGATCTTGGAAAACACAGG + Intronic
1185804043 X:3040605-3040627 CTCCTCAGCTTGGAAAAGAAAGG + Intergenic
1186872213 X:13784179-13784201 CTGGGGAGCTTGGAAAATACTGG + Intronic
1188717712 X:33480797-33480819 GTTCTCAGCTTGGAAATTATTGG - Intergenic
1192184023 X:68934405-68934427 CCACTCAGCTAGGATGATACAGG + Intergenic
1193847640 X:86494805-86494827 CTACTCATATTTGTAAATACTGG - Intronic
1194204940 X:91001834-91001856 TTACTCAGCTTGGAAAAGAAAGG + Intergenic
1194562063 X:95434030-95434052 CTATTCAGCATAGAAAATAATGG + Intergenic
1197032629 X:121836013-121836035 CTACTCATGTTAGAAAATGCAGG - Intergenic
1197186743 X:123595834-123595856 ATTCTCAGTTTGGAAAGTACTGG + Intergenic
1198305299 X:135376253-135376275 CTATTCAGCATGAAAAAAACAGG + Intergenic
1199974489 X:152884966-152884988 CTGCTCAGCTTGGGAAAAAGGGG - Intergenic
1200550766 Y:4576977-4576999 TTACTCAGCTTGGAAAAGAAAGG + Intergenic