ID: 910662902

View in Genome Browser
Species Human (GRCh38)
Location 1:89692925-89692947
Sequence CCCATGGGCTGTTTTGGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910662902_910662909 24 Left 910662902 1:89692925-89692947 CCAAATCCAAAACAGCCCATGGG 0: 1
1: 1
2: 0
3: 10
4: 130
Right 910662909 1:89692972-89692994 AGCAGTTAGAAACCAGAAACAGG 0: 1
1: 0
2: 2
3: 32
4: 352
910662902_910662910 30 Left 910662902 1:89692925-89692947 CCAAATCCAAAACAGCCCATGGG 0: 1
1: 1
2: 0
3: 10
4: 130
Right 910662910 1:89692978-89693000 TAGAAACCAGAAACAGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910662902 Original CRISPR CCCATGGGCTGTTTTGGATT TGG (reversed) Intronic