ID: 910662910

View in Genome Browser
Species Human (GRCh38)
Location 1:89692978-89693000
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910662902_910662910 30 Left 910662902 1:89692925-89692947 CCAAATCCAAAACAGCCCATGGG 0: 1
1: 1
2: 0
3: 10
4: 130
Right 910662910 1:89692978-89693000 TAGAAACCAGAAACAGGAACTGG No data
910662904_910662910 24 Left 910662904 1:89692931-89692953 CCAAAACAGCCCATGGGCAGACC No data
Right 910662910 1:89692978-89693000 TAGAAACCAGAAACAGGAACTGG No data
910662905_910662910 15 Left 910662905 1:89692940-89692962 CCCATGGGCAGACCGTTACCAAA 0: 1
1: 0
2: 0
3: 1
4: 43
Right 910662910 1:89692978-89693000 TAGAAACCAGAAACAGGAACTGG No data
910662908_910662910 -3 Left 910662908 1:89692958-89692980 CCAAATATAGAATTAGCAGTTAG No data
Right 910662910 1:89692978-89693000 TAGAAACCAGAAACAGGAACTGG No data
910662907_910662910 3 Left 910662907 1:89692952-89692974 CCGTTACCAAATATAGAATTAGC 0: 1
1: 0
2: 4
3: 49
4: 460
Right 910662910 1:89692978-89693000 TAGAAACCAGAAACAGGAACTGG No data
910662906_910662910 14 Left 910662906 1:89692941-89692963 CCATGGGCAGACCGTTACCAAAT No data
Right 910662910 1:89692978-89693000 TAGAAACCAGAAACAGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type