ID: 910666384

View in Genome Browser
Species Human (GRCh38)
Location 1:89729355-89729377
Sequence AAGCCTGCTTAGACCAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 79}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910666384_910666389 19 Left 910666384 1:89729355-89729377 CCTGGGTTGGTCTAAGCAGGCTT 0: 1
1: 0
2: 3
3: 6
4: 79
Right 910666389 1:89729397-89729419 ACCCGCTAAGGCCCCAAAGGAGG 0: 1
1: 0
2: 0
3: 3
4: 53
910666384_910666385 7 Left 910666384 1:89729355-89729377 CCTGGGTTGGTCTAAGCAGGCTT 0: 1
1: 0
2: 3
3: 6
4: 79
Right 910666385 1:89729385-89729407 CTTTTCCCTGACACCCGCTAAGG 0: 1
1: 0
2: 0
3: 6
4: 76
910666384_910666388 16 Left 910666384 1:89729355-89729377 CCTGGGTTGGTCTAAGCAGGCTT 0: 1
1: 0
2: 3
3: 6
4: 79
Right 910666388 1:89729394-89729416 GACACCCGCTAAGGCCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910666384 Original CRISPR AAGCCTGCTTAGACCAACCC AGG (reversed) Intronic
903762812 1:25711061-25711083 AAGCCATCCTAGACCAATCCTGG - Intronic
906793614 1:48679427-48679449 AAGCCTGCTCAGTACAACCAGGG + Intronic
908457865 1:64321703-64321725 AAGCCTTCTTTGACCTCCCCAGG + Intergenic
910666384 1:89729355-89729377 AAGCCTGCTTAGACCAACCCAGG - Intronic
912649990 1:111429546-111429568 AGGCCTCCTGAGACCAACACTGG + Intergenic
912976732 1:114337741-114337763 ACTCCTGCTTGGACCAACACAGG - Intergenic
913372672 1:118117812-118117834 AAGCCTTTTCAGAGCAACCCTGG - Intronic
913420383 1:118660761-118660783 AGCCCTGCTTAGAAAAACCCAGG + Intergenic
916684892 1:167135405-167135427 AGTCCTGCTTAGACCAGGCCTGG - Intergenic
918677724 1:187309100-187309122 AATCCTGTTTAGACCATCCCTGG + Intergenic
920355632 1:205370019-205370041 ATGCCTGCTTATACCAAATCTGG - Intergenic
1065429305 10:25637643-25637665 AAACCTGCTTAAACCAATTCAGG + Intergenic
1073930552 10:108569261-108569283 CAGGATGCTTAGACCAACACTGG + Intergenic
1076001970 10:126919659-126919681 AAGCTTTCTTATCCCAACCCAGG + Intronic
1077235416 11:1479827-1479849 AAGGCTGCTTTCAGCAACCCAGG + Intronic
1078896238 11:15599742-15599764 AAGCCTTCCTAGACCAGCCCAGG + Intergenic
1088075594 11:105844853-105844875 AAGCCTGCATAGAGAAACACAGG - Intronic
1091589382 12:1834431-1834453 GAGCCTGCTAAGCCCAAGCCCGG + Exonic
1092523777 12:9297308-9297330 AAGCCTTCTTTGACCTTCCCTGG - Intergenic
1092543520 12:9434591-9434613 AAGCCTTCTTTGACCTTCCCTGG + Intergenic
1094509424 12:31087465-31087487 AAGCCTTCTTTGACCTTCCCTGG - Intronic
1096839979 12:54374213-54374235 CAGCCTGCTGAGATCACCCCAGG - Intronic
1102802801 12:115751264-115751286 AAGCCTGCTTAGGCCAGGCATGG - Intergenic
1113423750 13:110190438-110190460 AAACCTGCTCAGACCAACCTGGG + Intronic
1113660404 13:112103645-112103667 AAGCCTGCTTAGACCTCCCCAGG + Intergenic
1116559888 14:46364395-46364417 CAGAGTGCTCAGACCAACCCTGG + Intergenic
1119160782 14:72451004-72451026 AGGCTTCCTTGGACCAACCCAGG - Intronic
1120993183 14:90396733-90396755 GCGCCTGCTTAGTCCAACCTGGG - Intronic
1130960828 15:88657667-88657689 AAGACTGCCTAGAGCATCCCTGG - Intergenic
1134397928 16:13882339-13882361 AAGGCTGGTTAGACCAGCACTGG + Intergenic
1141736457 16:85857385-85857407 GTGCCTGCTGAGAGCAACCCTGG - Intergenic
1142102366 16:88282058-88282080 ATGCCAGCTCATACCAACCCAGG - Intergenic
1144575468 17:16426915-16426937 AGGCCTGCTTGAAACAACCCTGG + Intronic
1144647055 17:16982196-16982218 AAGCCAGCTTGCAGCAACCCGGG + Intergenic
1148542823 17:48493520-48493542 AAGCCTGATGAGCCCAACGCTGG - Intergenic
1152361885 17:79836658-79836680 ATGCCTCCTTGGACCAACCCTGG + Intronic
1153259247 18:3207444-3207466 AGACCTGCTTTGACAAACCCTGG - Intronic
1157919048 18:51697228-51697250 GAGCCTTCTTGGACCAACACTGG - Intergenic
1162121722 19:8474109-8474131 AAGACTGCTTAGACTAAGCAGGG - Intronic
1163581440 19:18141661-18141683 AAGCTGGCTTAGACCAGGCCTGG - Intronic
1165113046 19:33513217-33513239 AGGCCAGCTTGGCCCAACCCTGG + Intronic
927146864 2:20171916-20171938 AAGCCTGCTGAGCCCAGCCTGGG + Intergenic
930004135 2:46882526-46882548 AATCCTGCTCTGGCCAACCCCGG - Intergenic
935091303 2:99897491-99897513 AGGCCTGCTCAGACCCACTCGGG + Intronic
935202350 2:100869224-100869246 AAGCATGTTTAGACCAAGCATGG - Intronic
935735811 2:106105896-106105918 AAGCTTGATTATAACAACCCTGG + Intronic
939497020 2:142936642-142936664 GAGCCTTCTTGGACCAACGCTGG + Intronic
940768573 2:157816720-157816742 GAGGCTGCACAGACCAACCCTGG + Intronic
942166407 2:173245166-173245188 AAGCCTACTAAGAGCAAGCCAGG + Intronic
944677527 2:202046823-202046845 AAGCCTGATAAGAGCACCCCTGG + Intergenic
945999364 2:216468090-216468112 AAGCCTGCTTAGAACAACTTGGG - Intronic
1170856495 20:20060990-20061012 AAAACTGCTTAGTTCAACCCAGG + Intronic
1173863963 20:46302542-46302564 AAGCCTTCTTGGACCCAGCCAGG - Intronic
1176173901 20:63708661-63708683 CAGCCTGCTCAGACGAATCCAGG - Exonic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1179812650 21:43882465-43882487 AAGCCTGCTTTGGCCAACCCCGG - Intronic
959524388 3:107360373-107360395 AGGCCTGCTTAGAGAAACTCAGG - Intergenic
965672176 3:171158218-171158240 AAGCCTGCTGAGTCCAAGTCAGG + Intronic
967015454 3:185477725-185477747 AAGCCTGAGCAGACCAACACAGG - Intronic
969474861 4:7416101-7416123 AGGCCTCCTTAATCCAACCCTGG - Intronic
971567682 4:28167049-28167071 AAGCCACCAGAGACCAACCCTGG - Intergenic
989238862 5:39180509-39180531 AAGGCTGACCAGACCAACCCAGG + Intronic
994177645 5:96729021-96729043 AAGCCCGCTTAGGCCCACTCAGG - Intronic
996785332 5:127230935-127230957 AAGCCTGCCTTGCCCAACTCTGG - Intergenic
998549207 5:143060678-143060700 AAGCATGGTTAGAATAACCCGGG + Intronic
1001582322 5:172807278-172807300 AAGCCTGCTGAAACCACCCTTGG - Intergenic
1007582875 6:42969613-42969635 AAGCCTGCTTAGAACATCCCTGG - Intronic
1013016968 6:106168656-106168678 AAGCCAGCTTAAGCCAACCAAGG - Intergenic
1018618858 6:165711715-165711737 AAGCCTGTTCAGAACAACCCAGG + Intronic
1021873047 7:25022451-25022473 CACCCTGCTGAGACCAAGCCAGG - Intergenic
1034954914 7:155328129-155328151 ACCCCTGCTCAGACCACCCCGGG + Intergenic
1035429984 7:158812115-158812137 AGGCCGGCTCAGACCCACCCTGG + Intronic
1035674836 8:1449339-1449361 AGGCATGCTTAGTCCAGCCCAGG + Intergenic
1038448900 8:27626276-27626298 AGGCCCGCTTAGACCTAGCCAGG + Intergenic
1040545113 8:48393022-48393044 ACGACTGCTCAGAACAACCCAGG + Intergenic
1050014966 9:1223837-1223859 AAGCCTTCTTAACCCAACCAAGG + Intergenic
1051029604 9:12658480-12658502 AAGCCTGCTTATGCCTGCCCTGG - Intergenic
1053347758 9:37390401-37390423 GTGCCAGCTTAGACCAACCAGGG - Intergenic
1055005312 9:71498880-71498902 AAGTCTGATTAGACCACCTCTGG + Intergenic
1056064448 9:82919085-82919107 AAGCCTGCTTGAACAAACACAGG + Intergenic
1058106185 9:100974607-100974629 CTCCCTGCTTAGACCAAACCCGG - Intergenic
1190709001 X:53051959-53051981 AAGCCTGCTTACACAAATGCAGG - Intronic
1192607581 X:72535069-72535091 AAACTTGCTAAGCCCAACCCTGG - Intronic
1192946478 X:75969153-75969175 AAGCCTTCTTGGACCAACGTTGG + Intergenic
1198112110 X:133510744-133510766 AAGCATGCTTAGAACAGTCCTGG - Intergenic