ID: 910667080

View in Genome Browser
Species Human (GRCh38)
Location 1:89737269-89737291
Sequence AAACCTACTTACACAAACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910667076_910667080 27 Left 910667076 1:89737219-89737241 CCTTCTGAAAAATACAACGTTAG No data
Right 910667080 1:89737269-89737291 AAACCTACTTACACAAACCTAGG 0: 1
1: 0
2: 1
3: 33
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910667080 Original CRISPR AAACCTACTTACACAAACCT AGG Intronic
901899469 1:12346642-12346664 AATCATACTTACATAAACCTGGG - Exonic
902353096 1:15873144-15873166 ATACCTGCCTACAGAAACCTTGG - Intronic
902428635 1:16344651-16344673 AAACCTTCTTATACATACATAGG + Intronic
903982096 1:27196440-27196462 GAGTGTACTTACACAAACCTAGG - Intergenic
904362155 1:29983254-29983276 AAACCAGCTTAAACAAACGTGGG + Intergenic
907018365 1:51040196-51040218 AAACCTACATACTCATACATAGG + Intergenic
907322081 1:53609786-53609808 GAATGTACTTACACAAACCTAGG + Intronic
908122048 1:60995085-60995107 AAACCTACTTCAACAAGCCTAGG + Intronic
908500360 1:64737475-64737497 GAATGTACATACACAAACCTAGG - Intergenic
908977432 1:69915337-69915359 TAACCTACTTAAATAAACCTAGG + Intronic
909045851 1:70708548-70708570 GAATGTAGTTACACAAACCTAGG - Intergenic
909486804 1:76183592-76183614 AAGTGTACTTACACAACCCTAGG + Intronic
909818353 1:80026131-80026153 CAGCATACTTACACAAATCTAGG + Intergenic
910143049 1:84047820-84047842 GAATATACTTACACAAACCTAGG + Intergenic
910157722 1:84239118-84239140 AAAACTAATTACAAAAATCTAGG + Intergenic
910324456 1:85989458-85989480 AAACCTCCCTCCACAACCCTAGG + Intronic
910667080 1:89737269-89737291 AAACCTACTTACACAAACCTAGG + Intronic
912055340 1:105590630-105590652 GGATGTACTTACACAAACCTAGG + Intergenic
913004400 1:114614715-114614737 TAACCTACTTAGAAATACCTGGG + Intronic
913324823 1:117617855-117617877 AAAGTTACTTAGACAAACATTGG - Intronic
913350263 1:117850614-117850636 AAGCTCACCTACACAAACCTGGG - Intergenic
915168310 1:153960817-153960839 AAGCCCAGTTACACAGACCTAGG + Intronic
917487878 1:175471386-175471408 GAATGCACTTACACAAACCTAGG + Intronic
917947233 1:179987276-179987298 AAAACTACTTACAGCAGCCTTGG - Exonic
920037231 1:203074231-203074253 GAATGTACTTACACAAACCTAGG + Intronic
921172800 1:212564200-212564222 GAGTGTACTTACACAAACCTAGG - Intergenic
921211076 1:212898754-212898776 AAGTGTACTTACACAAACCTAGG + Exonic
922127141 1:222738753-222738775 CAACTTATTTACAAAAACCTTGG - Intronic
922671954 1:227516518-227516540 GAATGTACTTACACAAACCTAGG + Intergenic
924638142 1:245808305-245808327 TAACACACATACACAAACCTGGG + Intronic
924821924 1:247501182-247501204 GGATGTACTTACACAAACCTAGG + Intergenic
1064669283 10:17692974-17692996 GAACCTCTTCACACAAACCTGGG + Intronic
1065781356 10:29171158-29171180 GAGTGTACTTACACAAACCTAGG + Intergenic
1066169946 10:32831046-32831068 GAGTATACTTACACAAACCTAGG + Intronic
1066637901 10:37524997-37525019 AAGTCAACTTACACAAACTTAGG + Intergenic
1067138213 10:43630564-43630586 ATATATACTTACACAAACCATGG - Intergenic
1067761603 10:49052369-49052391 AAAACTCCTTAGACAAACATGGG - Intronic
1068065397 10:52124252-52124274 GAGTCTACTCACACAAACCTAGG + Intronic
1069497526 10:68919100-68919122 GAGTGTACTTACACAAACCTAGG - Intronic
1069723139 10:70562108-70562130 AATCCTACTTCCATAAACCTGGG + Intronic
1070231838 10:74575902-74575924 AATCCTACTCACTCAAAACTAGG - Intronic
1073162353 10:101409520-101409542 TAGTGTACTTACACAAACCTAGG + Intronic
1074778316 10:116782769-116782791 GAATCTACTTGCACAAGCCTTGG - Intergenic
1076004904 10:126940771-126940793 TAAACTAATTACACAAACCCTGG - Intronic
1076458916 10:130625050-130625072 ATACCTACATACACACATCTTGG + Intergenic
1077361613 11:2143277-2143299 AAATCTATTCACACTAACCTGGG - Intronic
1077942541 11:6858916-6858938 ACATCTTCTTACTCAAACCTTGG + Intergenic
1078141352 11:8695451-8695473 AAGGCCACTTACCCAAACCTCGG + Exonic
1080511559 11:32978954-32978976 TAGTGTACTTACACAAACCTAGG + Exonic
1081472277 11:43386327-43386349 GAGTGTACTTACACAAACCTAGG + Intronic
1081476874 11:43442009-43442031 GTACTTACTTACACAAAGCTAGG + Intronic
1084135468 11:67176602-67176624 GAGTGTACTTACACAAACCTGGG + Intronic
1084293390 11:68192101-68192123 GAGTGTACTTACACAAACCTAGG - Intronic
1085949631 11:81314555-81314577 AAGTGTGCTTACACAAACCTAGG + Intergenic
1086796170 11:91105843-91105865 GAATGAACTTACACAAACCTAGG + Intergenic
1087114153 11:94506013-94506035 GAATGCACTTACACAAACCTAGG - Intergenic
1087550426 11:99640756-99640778 GAGTATACTTACACAAACCTAGG - Intronic
1089050588 11:115542043-115542065 GAGTCAACTTACACAAACCTGGG - Intergenic
1089803593 11:121061511-121061533 GAGTATACTTACACAAACCTAGG + Intronic
1089948516 11:122503107-122503129 GAGTATACTTACACAAACCTAGG - Intergenic
1090053860 11:123404902-123404924 AAACCTCCCTACAGCAACCTGGG - Intergenic
1091540541 12:1457195-1457217 AGACTGACTTACACAGACCTAGG - Intronic
1092913819 12:13171786-13171808 AAACCTACTTATAAAAACCAAGG - Intergenic
1093956432 12:25224788-25224810 GAATATACTTACACAAACCTTGG - Intronic
1094397781 12:30026206-30026228 GAGCGGACTTACACAAACCTAGG - Intergenic
1094812628 12:34153877-34153899 GAATGTACTCACACAAACCTAGG - Intergenic
1096452882 12:51759255-51759277 GAGTGTACTTACACAAACCTAGG - Intronic
1098658115 12:73058459-73058481 AAAATTACAAACACAAACCTTGG - Intergenic
1099273017 12:80537007-80537029 AAACCTACTTATTCACACCTGGG + Intronic
1099559791 12:84157287-84157309 GAAGCTACTCACACAAAACTGGG - Intergenic
1099925537 12:89011959-89011981 AAAGCTACTAACACAATACTTGG + Intergenic
1100915072 12:99411167-99411189 AAACCGCCTTACAAAACCCTGGG + Intronic
1106711680 13:32342566-32342588 GAGTATACTTACACAAACCTAGG + Intronic
1109234980 13:59805196-59805218 AAACATAATTACACAACACTGGG + Intronic
1109505325 13:63293468-63293490 GAATGTACTTACACAAACTTAGG + Intergenic
1109550936 13:63899195-63899217 AAACATATTTACACAAAACCTGG + Intergenic
1110104165 13:71649245-71649267 GAGCGTACTTACACAAACCTAGG - Intronic
1111782551 13:92746895-92746917 GAGTGTACTTACACAAACCTAGG + Intronic
1112902314 13:104373047-104373069 AATCCTACTTAAAGAAACATAGG + Intergenic
1113236821 13:108285404-108285426 GAGCATACTTACACAAACCTAGG + Intronic
1113423750 13:110190438-110190460 AAACCTGCTCAGACCAACCTGGG + Intronic
1114973958 14:28070701-28070723 AAGTGTACTTACACAAACGTAGG + Intergenic
1115475409 14:33808624-33808646 AGACCTACTTTCACAAAAATTGG - Intergenic
1115662574 14:35511668-35511690 AAAAGTACTTACAGAAAGCTGGG - Intergenic
1115666643 14:35556943-35556965 AAATGTATTTACACAAACTTTGG - Intronic
1115857149 14:37642722-37642744 TAGTGTACTTACACAAACCTAGG + Intronic
1115910551 14:38252494-38252516 GCACGTACTTACAAAAACCTAGG - Intergenic
1117863361 14:60117459-60117481 GAGCGTACATACACAAACCTAGG - Intronic
1118524862 14:66628297-66628319 AAATATGCTTACACAAACCTAGG + Intronic
1119783236 14:77292891-77292913 GTATGTACTTACACAAACCTAGG - Intronic
1120651057 14:87133414-87133436 AAACCATATTACACAAAACTGGG - Intergenic
1120783399 14:88507366-88507388 GAGTATACTTACACAAACCTAGG + Intronic
1124447925 15:29755240-29755262 GAGTGTACTTACACAAACCTAGG - Intronic
1124716033 15:32062877-32062899 GAGTCTACTTACACAGACCTAGG + Intronic
1125237864 15:37536855-37536877 ATAATTACTTACAAAAACCTAGG - Intergenic
1125772311 15:42177487-42177509 AAGCCTACTTATCCAAACATAGG + Intronic
1126054519 15:44717165-44717187 AGAAATGCTTACACAAACCTAGG + Intronic
1127010188 15:54617069-54617091 AAGTGTACTTACACAAACCTAGG - Intronic
1128016700 15:64354646-64354668 AAACCTCGTTTCACAAAACTGGG + Intronic
1129636910 15:77329515-77329537 AAACCTGCTTACTCTAACTTAGG - Intronic
1133556974 16:6915008-6915030 AAGCCGACTTACACCACCCTGGG - Intronic
1135198428 16:20414689-20414711 AAACCTACTTTCACATCCTTTGG - Intronic
1138103604 16:54274576-54274598 AGACCTAATTAGACAAACTTAGG - Intergenic
1138922168 16:61544597-61544619 AAACCTACTGAAACAAAACTGGG - Intergenic
1140418309 16:74793817-74793839 GTATGTACTTACACAAACCTAGG + Intergenic
1142931501 17:3288439-3288461 GAATGTACTTGCACAAACCTAGG - Intergenic
1144125037 17:12195383-12195405 ACACCTACACACACATACCTAGG - Intergenic
1146899560 17:36574306-36574328 GAGTGTACTTACACAAACCTAGG - Intronic
1147640511 17:41995652-41995674 AAGTATACTTACACAAACCTGGG - Intronic
1148361408 17:47015483-47015505 GCATATACTTACACAAACCTAGG - Intronic
1149621920 17:58051794-58051816 AAATATACTTACATAAACCCTGG + Intergenic
1152460845 17:80441601-80441623 AAACCAACTTAAGCAAAGCTGGG + Intergenic
1153298350 18:3570116-3570138 GAAGGTACTTACACAAACCTGGG - Intronic
1154953598 18:21233487-21233509 AAACATACTTACTAAAACCCAGG - Intergenic
1155822956 18:30401418-30401440 GAGTGTACTTACACAAACCTAGG - Intergenic
1156147437 18:34201964-34201986 AAAAATATTTACACAAATCTAGG - Intronic
1157532903 18:48437112-48437134 GAGTGTACTTACACAAACCTAGG + Intergenic
1164668523 19:30059524-30059546 AAAGCTTCTAACACAAAACTAGG - Intergenic
1165186257 19:34024879-34024901 GAGCATACTTACACTAACCTAGG - Intergenic
1168478492 19:56696298-56696320 GAGTGTACTTACACAAACCTTGG + Intergenic
926767828 2:16337843-16337865 CATCACACTTACACAAACCTAGG - Intergenic
926771913 2:16385633-16385655 AAAGCCACTAACACACACCTGGG - Intergenic
927732254 2:25484145-25484167 GAGTGTACTTACACAAACCTAGG - Intronic
928152883 2:28848008-28848030 TAGTGTACTTACACAAACCTAGG - Intronic
928779049 2:34798736-34798758 GAACGTACTTACACAAACATAGG - Intergenic
928818692 2:35332869-35332891 AAACCTAATTAAAAAAACATAGG - Intergenic
930490776 2:52067553-52067575 GAGCATACTTACACAAACCTAGG - Intergenic
931826993 2:66010889-66010911 AAACAAACTGTCACAAACCTTGG + Intergenic
932081230 2:68717061-68717083 GAATATACTTACACAAAACTAGG + Intronic
932141702 2:69284305-69284327 GAGTGTACTTACACAAACCTAGG - Intergenic
932309270 2:70726781-70726803 AAAGCTACCTCCCCAAACCTGGG - Intronic
933425021 2:82099662-82099684 GAGTGTACTTACACAAACCTAGG - Intergenic
933844003 2:86310458-86310480 GAGTGTACTTACACAAACCTAGG - Intronic
935206820 2:100903474-100903496 TCACCTACGTACACAAACATGGG - Intronic
935921773 2:108023236-108023258 AAACCTACTTTCCCAATACTTGG + Intergenic
936748995 2:115617698-115617720 GAGTGTACTTACACAAACCTAGG - Intronic
936842850 2:116794315-116794337 AAACCTACTTAGACGAAGGTAGG - Intergenic
937180101 2:119987430-119987452 AAACCTATTGACAAAAGCCTTGG + Intergenic
939836495 2:147135789-147135811 AAACCTACTTATGTAATCCTTGG - Intergenic
940227727 2:151417814-151417836 AAGAGGACTTACACAAACCTAGG + Intronic
940354736 2:152727790-152727812 GAGCGTACTTACAAAAACCTAGG - Intronic
941470338 2:165877579-165877601 GAGTATACTTACACAAACCTAGG - Intronic
941759444 2:169225274-169225296 AATACTACTTACACAAACATTGG - Intronic
942049436 2:172125206-172125228 GAGTGTACTTACACAAACCTAGG - Intergenic
942881428 2:180866136-180866158 AAGTATACTTACACAAACCTAGG + Intergenic
943046927 2:182870737-182870759 AGACTTATTAACACAAACCTAGG - Intergenic
943206452 2:184903496-184903518 GAGTGTACTTACACAAACCTAGG - Intronic
943261233 2:185666098-185666120 AAATGTACTTACATAAACCTAGG + Intergenic
944075905 2:195730488-195730510 AAACCTACTGACAAAAGACTGGG - Intronic
944827402 2:203499036-203499058 AATTGTACTTACACAAACCCAGG - Intronic
945095295 2:206213573-206213595 CAAACTTCTTACACAAACATAGG - Intronic
947047199 2:226001302-226001324 GAATGTACTTACACAAACCTAGG + Intergenic
948330204 2:237158482-237158504 GAGTGTACTTACACAAACCTAGG - Intergenic
1169874967 20:10287050-10287072 AAACCTATACACTCAAACCTAGG + Intronic
1170259515 20:14388305-14388327 AAAACTACTTACATAAGGCTGGG - Intronic
1170535425 20:17336316-17336338 AAACCTAGTCACTCAAACCCAGG + Intronic
1172492777 20:35354110-35354132 GAGTATACTTACACAAACCTCGG - Intronic
1172892389 20:38275818-38275840 CAGTGTACTTACACAAACCTAGG + Intronic
1173282783 20:41644135-41644157 AAACTTACTGACACTCACCTTGG + Intergenic
1174491510 20:50900349-50900371 AAGGGTACTTACACAGACCTAGG - Intronic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1177723187 21:24933946-24933968 GGACGTACTTACACAAACTTAGG - Intergenic
1178742467 21:35215043-35215065 AACTCTACTTCCACCAACCTCGG + Intronic
1178766361 21:35455355-35455377 AAACATACATACATAAAACTGGG + Intronic
1180133197 21:45841102-45841124 GAATATACTTACCCAAACCTAGG - Intronic
1182099883 22:27650400-27650422 AAACCTAAATTCAGAAACCTGGG - Intergenic
950852200 3:16072873-16072895 AAGTACACTTACACAAACCTAGG - Intergenic
951435562 3:22659198-22659220 AAATCTAAATACAGAAACCTAGG + Intergenic
951527300 3:23665690-23665712 GAGTGTACTTACACAAACCTTGG + Intergenic
951953859 3:28232232-28232254 GAACCAACTTAAACAAACATGGG + Intergenic
952311481 3:32194512-32194534 AAACCCACTCCCACACACCTTGG + Intergenic
952639953 3:35581306-35581328 AAGCTTACTGAAACAAACCTTGG + Intergenic
953031402 3:39182257-39182279 AAACCTAGTTTCAAAAGCCTGGG + Intergenic
953678556 3:45022178-45022200 GAGTGTACTTACACAAACCTAGG + Intronic
957021121 3:75127764-75127786 GAGTGTACTTACACAAACCTAGG - Intergenic
957633548 3:82750716-82750738 GAATGTATTTACACAAACCTAGG + Intergenic
957743861 3:84312306-84312328 AAACCTACTCACATTAACTTAGG + Intergenic
959918877 3:111848944-111848966 GAGTCCACTTACACAAACCTAGG - Intronic
960440768 3:117684923-117684945 AAACCAACTGATACTAACCTGGG - Intergenic
960685829 3:120292458-120292480 AAACACACTTACACAGACCAGGG + Intergenic
962028843 3:131577400-131577422 GAGTATACTTACACAAACCTAGG + Intronic
964338188 3:155679674-155679696 AAACCTACTGACGCAAACCTAGG + Intronic
964371974 3:156009400-156009422 AAACTTACTAACACAACCATGGG - Intergenic
967507986 3:190275273-190275295 AAACCTAATTCCACAAATTTCGG - Intergenic
967547209 3:190745356-190745378 GATTGTACTTACACAAACCTGGG - Intergenic
970672973 4:18417399-18417421 GAGTGTACTTACACAAACCTAGG + Intergenic
971363960 4:25961219-25961241 CAGCGTACTTACACAAGCCTAGG + Intergenic
971949719 4:33329454-33329476 AAACCTCATTATACAAACATAGG + Intergenic
973725282 4:53769564-53769586 GAGCATACTGACACAAACCTAGG - Intronic
973953862 4:56043353-56043375 GAGTGTACTTACACAAACCTAGG + Intergenic
974139733 4:57870234-57870256 GAGTGTACTTACACAAACCTAGG - Intergenic
974673967 4:65066698-65066720 AAACCTAGATTGACAAACCTGGG - Intergenic
976628526 4:87212878-87212900 GAGTATACTTACACAAACCTAGG - Intronic
977606564 4:98990426-98990448 AAGTGTCCTTACACAAACCTAGG + Intergenic
977779848 4:100968200-100968222 GAGTGTACTTACACAAACCTAGG - Intergenic
978624882 4:110673967-110673989 GAGTGTACTTACACAAACCTAGG - Intergenic
978854332 4:113376197-113376219 GAATGTCCTTACACAAACCTAGG + Intronic
980224044 4:129957919-129957941 TCATCTACTTACACAAATCTAGG - Intergenic
980497240 4:133602272-133602294 AGACTTGCTTACAAAAACCTTGG + Intergenic
981718346 4:147774435-147774457 AACCCTACAGACACAAACCCAGG - Intronic
983097589 4:163582494-163582516 AAATCTTCATAGACAAACCTTGG - Intronic
983720648 4:170847532-170847554 AAACCAACTTGCACACACATTGG - Intergenic
983932511 4:173468369-173468391 GAGTGTACTTACACAAACCTAGG - Intergenic
984272401 4:177563320-177563342 AAGTGTACTTACACAAATCTAGG - Intergenic
987901379 5:24016548-24016570 GAATATACTTACACAAACCTAGG + Intronic
988678679 5:33461411-33461433 AAACTAGCTTACACAAACCTAGG - Intronic
990130093 5:52570869-52570891 AAACATACATTCACAAAACTGGG - Intergenic
990793814 5:59516921-59516943 AAACATACATACACATACATAGG + Intronic
991939096 5:71832936-71832958 GAGTGTACTTACACAAACCTAGG - Intergenic
992827388 5:80564403-80564425 GAACCTCCTGACACCAACCTTGG - Intronic
993922586 5:93825992-93826014 AAACCTAAATATATAAACCTAGG + Intronic
996518910 5:124404568-124404590 GAATGTATTTACACAAACCTAGG - Intergenic
996545461 5:124673495-124673517 AAACATTCTTACACAATGCTAGG + Intronic
997058012 5:130467611-130467633 AAACCTACCTGCACAAACCCAGG + Intergenic
997475166 5:134138556-134138578 AAACCTGCTGACTCAACCCTGGG + Intronic
998212803 5:140213810-140213832 TAGTGTACTTACACAAACCTAGG - Intronic
998899068 5:146832868-146832890 GAGTGTACTTACACAAACCTGGG - Intronic
999512863 5:152270896-152270918 GAGCATATTTACACAAACCTAGG + Intergenic
1002047056 5:176547992-176548014 ACAGTGACTTACACAAACCTAGG + Intronic
1002341742 5:178520983-178521005 GCATGTACTTACACAAACCTAGG + Intronic
1008322401 6:50133160-50133182 AAACCTACTCCTAAAAACCTGGG - Intergenic
1010103122 6:72133680-72133702 AAACCTAGTTGCAGAAAACTTGG - Intronic
1011576162 6:88802527-88802549 AAACATACTTTCACAGAGCTAGG + Intronic
1013968061 6:115979880-115979902 AAGTGTACTCACACAAACCTAGG - Intronic
1014329459 6:120042802-120042824 ATATCTATTTACATAAACCTTGG - Intergenic
1015747674 6:136527441-136527463 AAACCTACTTACCCAAAAGAGGG + Intronic
1015781231 6:136868186-136868208 GAGTGTACTTACACAAACCTAGG - Intronic
1016349222 6:143149006-143149028 GAGTGTACTTACACAAACCTAGG - Intronic
1016608234 6:145959491-145959513 GAGTATACTTACACAAACCTAGG - Intronic
1018161871 6:161052784-161052806 AAAACGACTAAAACAAACCTGGG - Intronic
1018695277 6:166386129-166386151 ACACTCACTTCCACAAACCTGGG - Intergenic
1020534885 7:9384663-9384685 AAACCATCTTACACAAAAATTGG - Intergenic
1020995371 7:15256807-15256829 TACAGTACTTACACAAACCTAGG - Intronic
1021392207 7:20106567-20106589 AAACCCATTTACCCAAACCAAGG + Intergenic
1021880311 7:25089034-25089056 CAGTGTACTTACACAAACCTAGG - Intergenic
1022361626 7:29665300-29665322 AAACATGCATATACAAACCTGGG + Intergenic
1022565891 7:31401484-31401506 AGACATATTTACACTAACCTAGG - Intergenic
1022699761 7:32748421-32748443 AAACATGCATATACAAACCTGGG - Intergenic
1025919498 7:65898008-65898030 AAACCTAATTACCCATAACTAGG + Intronic
1027686862 7:81289346-81289368 AGACCTACTTCCCTAAACCTTGG + Intergenic
1027947798 7:84771871-84771893 AAACATACTGAAACAAACTTTGG + Intergenic
1028681685 7:93542187-93542209 CAGTGTACTTACACAAACCTAGG + Intronic
1030481438 7:110109687-110109709 GAGCTTACTTACACAAACCTAGG - Intergenic
1031316972 7:120270838-120270860 GAGCGTACTTACACAAACTTAGG - Intergenic
1031846567 7:126812324-126812346 GACTGTACTTACACAAACCTAGG + Intronic
1032595774 7:133238407-133238429 AAAGCTACTTACAGAAAAGTTGG + Intergenic
1033398498 7:140998975-140998997 GAGTGTACTTACACAAACCTAGG + Intergenic
1033666079 7:143441928-143441950 TAACCTACTTACACTCACCTGGG + Intergenic
1043690929 8:83150651-83150673 AAAACTCCTTTCACAAACATTGG - Intergenic
1045484547 8:102621001-102621023 GAATGAACTTACACAAACCTAGG - Intergenic
1046080195 8:109362293-109362315 AAACCTCCACACTCAAACCTGGG - Intergenic
1046950132 8:120012298-120012320 GAGTGTACTTACACAAACCTGGG + Intronic
1047870230 8:129074296-129074318 AAACCTCATTACACAGTCCTTGG - Intergenic
1048085769 8:131177521-131177543 AAGTGTATTTACACAAACCTAGG + Intergenic
1048929422 8:139299842-139299864 GAAGGTACTCACACAAACCTAGG + Intergenic
1049810792 8:144569160-144569182 AAATCTACTTACATTAATCTTGG - Intronic
1051808733 9:21026588-21026610 AAACCTACCTGCAAAAACCTTGG + Exonic
1052838501 9:33270304-33270326 CAATGTATTTACACAAACCTAGG - Intronic
1053049592 9:34948660-34948682 AAGTGTACCTACACAAACCTAGG - Intergenic
1056953259 9:91062695-91062717 ACACCTGCTTACAGAAACTTTGG + Intergenic
1058254988 9:102750568-102750590 TAACTTACTTACAGAAATCTTGG - Intergenic
1058840685 9:108905696-108905718 TAGAGTACTTACACAAACCTAGG + Intronic
1061562772 9:131417130-131417152 AAACCTATATACACCAACATGGG - Intronic
1188386296 X:29563404-29563426 AAAACCACTTACAGAAAACTAGG - Intronic
1188836742 X:34966975-34966997 AAACTTACATTCACAAACTTTGG - Intergenic
1188928970 X:36081356-36081378 AAACCTACTAACAAAAGCCATGG + Intronic
1191869253 X:65731642-65731664 AAATCTCCTAACAAAAACCTAGG - Intronic
1192218931 X:69183608-69183630 ACATCTAGTTACACAAGCCTAGG + Intergenic
1194760566 X:97791482-97791504 AAATCATCTCACACAAACCTTGG + Intergenic
1197138208 X:123087469-123087491 AAGTATACTTGCACAAACCTAGG - Intergenic
1197186913 X:123597898-123597920 AAACATACTTACAAAAAACAAGG + Intergenic
1197599408 X:128510077-128510099 GAATGTACTTACACAAATCTAGG - Intergenic
1197645088 X:129008753-129008775 GAGTGTACTTACACAAACCTAGG + Intergenic
1199567001 X:149225884-149225906 GAGGCTACTTACACAAACTTAGG + Intergenic
1201757716 Y:17504852-17504874 GAATGTACTTACACAAACCTAGG - Intergenic
1201843838 Y:18401130-18401152 GAATGTACTTACACAAACCTAGG + Intergenic