ID: 910667562

View in Genome Browser
Species Human (GRCh38)
Location 1:89741506-89741528
Sequence CAGACAATGCAGTACCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910667557_910667562 27 Left 910667557 1:89741456-89741478 CCATTACTAGTTTATTACAAAGG 0: 1
1: 3
2: 14
3: 40
4: 193
Right 910667562 1:89741506-89741528 CAGACAATGCAGTACCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910667562 Original CRISPR CAGACAATGCAGTACCTGGA GGG Intronic
No off target data available for this crispr