ID: 910675728

View in Genome Browser
Species Human (GRCh38)
Location 1:89814805-89814827
Sequence CATGCAACTCACATTGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 217}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910675728_910675733 17 Left 910675728 1:89814805-89814827 CCTATTTCAATGTGAGTTGCATG 0: 1
1: 0
2: 2
3: 21
4: 217
Right 910675733 1:89814845-89814867 TAACTTGGGGCTTTTAGTCCAGG 0: 1
1: 0
2: 1
3: 5
4: 84
910675728_910675734 24 Left 910675728 1:89814805-89814827 CCTATTTCAATGTGAGTTGCATG 0: 1
1: 0
2: 2
3: 21
4: 217
Right 910675734 1:89814852-89814874 GGGCTTTTAGTCCAGGCAACTGG 0: 1
1: 0
2: 0
3: 9
4: 113
910675728_910675730 2 Left 910675728 1:89814805-89814827 CCTATTTCAATGTGAGTTGCATG 0: 1
1: 0
2: 2
3: 21
4: 217
Right 910675730 1:89814830-89814852 ATAAAGAGTCAAGGATAACTTGG 0: 1
1: 0
2: 0
3: 19
4: 243
910675728_910675731 3 Left 910675728 1:89814805-89814827 CCTATTTCAATGTGAGTTGCATG 0: 1
1: 0
2: 2
3: 21
4: 217
Right 910675731 1:89814831-89814853 TAAAGAGTCAAGGATAACTTGGG 0: 1
1: 1
2: 2
3: 21
4: 198
910675728_910675732 4 Left 910675728 1:89814805-89814827 CCTATTTCAATGTGAGTTGCATG 0: 1
1: 0
2: 2
3: 21
4: 217
Right 910675732 1:89814832-89814854 AAAGAGTCAAGGATAACTTGGGG No data
910675728_910675729 -7 Left 910675728 1:89814805-89814827 CCTATTTCAATGTGAGTTGCATG 0: 1
1: 0
2: 2
3: 21
4: 217
Right 910675729 1:89814821-89814843 TTGCATGAGATAAAGAGTCAAGG 0: 1
1: 0
2: 2
3: 15
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910675728 Original CRISPR CATGCAACTCACATTGAAAT AGG (reversed) Intronic
902553116 1:17230864-17230886 TATGCAAATCACATGCAAATAGG + Intronic
903896035 1:26605578-26605600 CATGCAACTTACATTCTAATGGG + Intergenic
907574870 1:55517316-55517338 CTTGGAACTTACATTGTAATGGG + Intergenic
907859128 1:58334042-58334064 CAGGCATCTCACATGGCAATAGG - Intronic
907987955 1:59551686-59551708 CATGCAGCTCACAAGGAACTGGG - Intronic
909226383 1:73029550-73029572 AATGCAGCTCAAAATGAAATTGG + Intergenic
910029171 1:82695351-82695373 CAGGGAACTCACACTGAAATAGG + Intergenic
910675728 1:89814805-89814827 CATGCAACTCACATTGAAATAGG - Intronic
911534695 1:99087049-99087071 CATGAAGCTCACATTTACATGGG + Intergenic
911626422 1:100130210-100130232 CAAGGAACTCACATTTTAATAGG - Intronic
911733900 1:101316534-101316556 CATGCAAGTCACATAGAAGGAGG + Intergenic
912017077 1:105053540-105053562 CATGCAAGTCACATTTAGATAGG - Intergenic
914409486 1:147412258-147412280 CATGCAAATCATAATCAAATTGG - Intergenic
916269513 1:162925283-162925305 CATGGAACTCAGATTTAATTGGG - Intergenic
916815137 1:168344318-168344340 CATGTGACTCACAGTGAAACAGG + Intergenic
916911383 1:169350834-169350856 CATGCACATCACATGTAAATGGG + Intronic
918636537 1:186781132-186781154 CATGCAACTTTCATTTGAATAGG - Intergenic
920582160 1:207120356-207120378 CATGAAATTCACATTTAACTAGG + Intronic
921215211 1:212931037-212931059 GATGCTACCCACATTGAAAAGGG - Intergenic
922080007 1:222286505-222286527 CATGCAACTCCTAATGAAAAGGG + Intergenic
923483138 1:234403539-234403561 CATGTGACTCACAGTCAAATGGG - Intronic
924249820 1:242120809-242120831 CTTGCATTTCCCATTGAAATTGG - Intronic
924423890 1:243933515-243933537 CATGGAACTTATATTCAAATGGG + Intergenic
924876397 1:248109762-248109784 CATTCAAAGCACATAGAAATGGG + Intergenic
1063260029 10:4377642-4377664 CATGCAAAACAGATAGAAATGGG + Intergenic
1063288348 10:4713915-4713937 CATGAGACTCACATTAAAGTTGG + Intergenic
1064414918 10:15140690-15140712 CAAGAAACTCACAGTGAAAAGGG - Intronic
1064816029 10:19263630-19263652 CATGCAAAGCAAAATGAAATTGG - Intronic
1068227861 10:54129973-54129995 CATGTAACTCACATTCCATTTGG - Intronic
1068503444 10:57868994-57869016 GATGCAACTAACATTTAAATTGG - Intergenic
1069126947 10:64647353-64647375 CATGCAACTTATATTCTAATGGG + Intergenic
1069281558 10:66660873-66660895 CATGGAGCTCACATTTCAATAGG - Intronic
1069623433 10:69851953-69851975 CATTAAACTAAAATTGAAATAGG - Intronic
1069765361 10:70852860-70852882 CATGGAACTTACATTTTAATAGG + Intronic
1072173388 10:92890505-92890527 CATGCAACTTACATTCCAGTAGG + Intronic
1072979926 10:100091645-100091667 CATGCAACTTACATTTTAGTGGG - Intergenic
1073665793 10:105532332-105532354 CATGAAGCTCACATTTGAATAGG - Intergenic
1073958725 10:108901809-108901831 CATCCGACCCACATTAAAATGGG + Intergenic
1074114802 10:110447705-110447727 CATGAAACTTACATTTTAATTGG - Intergenic
1074848990 10:117423685-117423707 CATGCAGCTGACATTCTAATGGG + Intergenic
1077992683 11:7425947-7425969 CATTTAAATCACATTAAAATAGG + Intronic
1078982803 11:16556979-16557001 CATTTAACTGACATTGAAAAAGG - Intronic
1082090301 11:48083646-48083668 CATGCAGCTCACATTCTCATAGG - Intronic
1086140735 11:83496339-83496361 CTTGCAACTCTCATTTAAATTGG + Intronic
1087071103 11:94081749-94081771 CATGAAACTCACATTGCAGTAGG + Intronic
1087193316 11:95279303-95279325 CATGGAACTCACATTTCAGTAGG + Intergenic
1087790545 11:102402261-102402283 CATGAAAGTCTCAGTGAAATGGG - Intronic
1088720010 11:112584120-112584142 CAGGGAACTCACATTTTAATTGG + Intergenic
1089600889 11:119614231-119614253 CTTGCCACTCACATTGGCATTGG - Intergenic
1090201057 11:124856722-124856744 CGAGAAACTAACATTGAAATGGG - Intergenic
1090232525 11:125118874-125118896 CATGGAACTCACATTCTAGTGGG + Intergenic
1090479901 11:127058923-127058945 CATGTAACTCACATTCAATTAGG - Intergenic
1093970028 12:25367845-25367867 CAAGCAACTCACATTAAAATGGG - Intergenic
1094094547 12:26688813-26688835 CATGCAAATCACCGTGAAAGTGG - Intronic
1097425517 12:59439754-59439776 CCTGCAACACAAATTGAAAAGGG - Intergenic
1097695542 12:62771822-62771844 TATGGAACTCACATTGTAACGGG - Intronic
1098787143 12:74773952-74773974 GGTGCAACTCACATTGGAAGAGG + Intergenic
1098804971 12:75011986-75012008 CATGGAATTCACATTGTAATGGG - Intergenic
1099847616 12:88048033-88048055 CATGAAGCTCACATTCTAATGGG + Intronic
1100861024 12:98807219-98807241 CATGCAGCTCAGAGTAAAATGGG + Intronic
1101176904 12:102161590-102161612 CATGGAACTCACAAAGTAATAGG + Intronic
1101473392 12:105020541-105020563 CATGAAACTTACATTCTAATGGG + Exonic
1101520062 12:105474408-105474430 CATGGAACTTCCATTCAAATGGG + Intergenic
1103816336 12:123659882-123659904 CATCGAAATCTCATTGAAATTGG + Exonic
1107113788 13:36725145-36725167 CATGGAACTTACATTCTAATGGG + Intergenic
1109703222 13:66054507-66054529 CATTCAACTCACATTTTGATGGG + Intergenic
1109732169 13:66427576-66427598 GATGCAATTCAAATAGAAATGGG - Intronic
1112346324 13:98593034-98593056 AATGCAGCGCTCATTGAAATGGG + Intergenic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1117320482 14:54618137-54618159 GGTGCAACTCAGATTAAAATTGG + Intronic
1118001653 14:61528596-61528618 CAAGGAACTCACAGTGTAATGGG - Intronic
1118157934 14:63258912-63258934 AATGCAACTCAAATATAAATGGG - Intronic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1126202006 15:45997009-45997031 TATGCAACTCTCATCAAAATAGG - Intergenic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1135160141 16:20087047-20087069 CATGGACCTCACATTAAAGTAGG - Intergenic
1137685690 16:50385294-50385316 CATGCACCTCGCAGAGAAATGGG - Intergenic
1137939350 16:52668114-52668136 CACGCAGCTCACCTTGAATTTGG + Intergenic
1138312614 16:56040800-56040822 CATGAAACTCACAGCTAAATAGG - Intergenic
1139187705 16:64826385-64826407 CTTGCATATGACATTGAAATTGG - Intergenic
1140577023 16:76182665-76182687 CCTCCAACTCACATTGCAATTGG - Intergenic
1143740191 17:8946980-8947002 CATGGAGCTCACATTCTAATGGG - Intronic
1144014888 17:11184672-11184694 GATGCAGCTCACATTGGCATAGG + Intergenic
1144635675 17:16907360-16907382 CATGGAACTTACATTGTCATTGG + Intergenic
1146036074 17:29407844-29407866 CATGTTATTAACATTGAAATAGG - Intronic
1146097256 17:29943519-29943541 AAATCAAGTCACATTGAAATTGG + Intronic
1146538829 17:33677020-33677042 CATGCCACTCACAGTGGAAGGGG - Intronic
1148148188 17:45379228-45379250 CATGCAGCTCACATTCTAGTGGG + Intergenic
1149402522 17:56312778-56312800 CATGCAACTCACAGTCTAAAAGG + Intronic
1150428395 17:65095510-65095532 CTTGCTACTCAGATTGAAGTTGG + Intergenic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1156743233 18:40358394-40358416 TATGCATCTCACATTGCAGTAGG - Intergenic
1158225203 18:55193743-55193765 CAAGAAACTGACATTGACATTGG - Intergenic
1159428979 18:68326356-68326378 AATGCAAGTCTCATTGCAATGGG - Intergenic
1162536807 19:11267397-11267419 CATGGAGCTGACATTGGAATGGG - Intergenic
925612237 2:5711338-5711360 GATGAAACCCACATTTAAATAGG - Intergenic
929347279 2:40900252-40900274 CATGTGAGTCACATTGTAATTGG + Intergenic
936724540 2:115297126-115297148 CATGCTGCTCACATAGAAAATGG - Intronic
936896075 2:117429110-117429132 CATGAAACTCAGATTCAAAAAGG + Intergenic
937289594 2:120774050-120774072 CCTGCTCCTCACCTTGAAATTGG - Intronic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
938583404 2:132668449-132668471 CGTGCAATTCACAATGAACTCGG + Exonic
938893340 2:135727168-135727190 CATGGAAATAACAATGAAATTGG + Intergenic
939012733 2:136865387-136865409 CATGGATCTCAAATTGAAATAGG - Intronic
940205996 2:151202418-151202440 GATGAGACTGACATTGAAATTGG + Intergenic
941599970 2:167530340-167530362 CATGCAACTTACATTCTAGTGGG - Intergenic
942075940 2:172357327-172357349 CATGCAAAACACATGAAAATGGG - Intergenic
942082622 2:172415688-172415710 CTGGCAACTCTTATTGAAATTGG - Intergenic
942623390 2:177872782-177872804 CATGGAAGGGACATTGAAATGGG - Intronic
943258278 2:185625922-185625944 CATGAAATTCACATGAAAATTGG + Intergenic
944204889 2:197147695-197147717 CATGAAACTCACATTCAAGTGGG + Intronic
944816409 2:203380949-203380971 CATGCAAATTTCATTTAAATTGG + Intronic
945102360 2:206274286-206274308 GATGCACCTCACTATGAAATAGG + Intergenic
1169172550 20:3477002-3477024 CATGGAACTTACATTGCACTGGG - Intronic
1169172563 20:3477079-3477101 CATGGAACTTACATTGCACTGGG - Intronic
1169172576 20:3477156-3477178 CATGGAACTTACATTGCACTGGG - Intronic
1169172589 20:3477233-3477255 CATGGAACTTACATTGCACTGGG - Intronic
1169172602 20:3477310-3477332 CATGGAACTTACATTGCACTGGG - Intronic
1169172615 20:3477387-3477409 CATGGAACTTACATTGCACTGGG - Intronic
1169172628 20:3477464-3477486 CATGGAACTTACATTGCACTGGG - Intronic
1169172641 20:3477541-3477563 CATGGAACTTACATTGCACTGGG - Intronic
1169172654 20:3477618-3477640 CATGGAACTTACATTGTACTGGG - Intronic
1169172667 20:3477695-3477717 CATGGAACTTACATTGCACTGGG - Intronic
1169291402 20:4356132-4356154 CATGCAGCTCATATTCCAATGGG - Intergenic
1169634074 20:7667223-7667245 CATGAAGCTCACATTGTAACAGG - Intergenic
1174202170 20:48814292-48814314 CATGCAACTTACATTCTAATGGG + Intronic
1176710085 21:10143797-10143819 CATGCATTTGTCATTGAAATTGG + Intergenic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1178240192 21:30890589-30890611 ACTGTAACTCACATTGAAATCGG - Intergenic
1179555985 21:42176472-42176494 CCTCAAACTCACAGTGAAATAGG + Intergenic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
1180692978 22:17732971-17732993 CATGGAACTCACACGGAAAAAGG - Intergenic
1181413262 22:22739794-22739816 CATGAAACACATTTTGAAATGGG - Intronic
1181901401 22:26159279-26159301 CATGCAACTGACATTCTAGTTGG + Intergenic
1182807215 22:33083214-33083236 CTTGAGACTCACATTGACATGGG - Intergenic
1184679990 22:46066051-46066073 AATGGAACTCATACTGAAATTGG - Intronic
1184909744 22:47522159-47522181 CATGCAACACACATTCTCATAGG - Intergenic
949214406 3:1548135-1548157 CATGAAACACTGATTGAAATGGG + Intergenic
949353658 3:3153831-3153853 CATGCAATTCAGATTTCAATTGG - Intronic
950912894 3:16613689-16613711 CAAGCAACTCAAAGGGAAATTGG - Intronic
950959845 3:17094073-17094095 CATGGAACTCACAGTGTAATTGG + Intergenic
952568927 3:34690303-34690325 GATGCAAGTCATATTGAATTAGG - Intergenic
955835987 3:63055766-63055788 CATGCAACTCTCATCAAAACAGG - Intergenic
955912585 3:63873112-63873134 CATGAATTTCACATTGAAAAGGG - Intronic
956936016 3:74102793-74102815 CATGCCTCTCACATGGAGATGGG + Intergenic
959067404 3:101672477-101672499 ATTGCAACTCACATGAAAATGGG - Intronic
959445099 3:106429392-106429414 CATGGAACTCACATTGTAATTGG - Intergenic
960129710 3:114043014-114043036 CATGAAACTTACATTCCAATTGG + Intronic
960320130 3:116224501-116224523 AATGCAACTCAGATTGGAACAGG + Intronic
960622605 3:119651447-119651469 CATGCAATTTACATTCTAATGGG - Intronic
960794881 3:121474817-121474839 CATGCAACTCAAATTTAACTGGG - Intronic
961458575 3:127036320-127036342 CATGCTACTCACATGGACAAGGG - Exonic
962159708 3:132986021-132986043 CATGCAGCTTACATTCCAATAGG - Intergenic
963707057 3:148699907-148699929 CATCCAACTCAGAATAAAATTGG + Intronic
963754727 3:149223257-149223279 CATGCAACTTACATTCTACTTGG + Intergenic
964386507 3:156153546-156153568 CATGAAATTAACATTGGAATTGG + Intronic
964644226 3:158941215-158941237 CATGGTACTCACATAAAAATGGG + Intergenic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
967333328 3:188315166-188315188 CATGCAAATGAATTTGAAATAGG - Intronic
973147513 4:46846294-46846316 CATGAAACTCACATTCTAGTAGG + Intronic
975883149 4:78935300-78935322 CATGCAACTGAGATTCACATTGG + Intronic
976901401 4:90181200-90181222 CCTGCAACTAAAATAGAAATTGG + Intronic
977099631 4:92794285-92794307 TAGGCAACTCATATTGCAATTGG + Intronic
979684153 4:123493523-123493545 CATGAAATTAACATAGAAATTGG - Intergenic
979891153 4:126097042-126097064 CATACAAGTCATATTCAAATAGG + Intergenic
980264391 4:130496053-130496075 CGTGAAAGTCAGATTGAAATGGG + Intergenic
980478361 4:133350978-133351000 CATGTAATTCTCATTAAAATAGG + Intergenic
981319256 4:143372435-143372457 CATGAAACTTACATTGTAGTAGG + Intronic
981429254 4:144641372-144641394 CATGGAACTCATATTGTAATGGG - Intergenic
982423689 4:155229991-155230013 CTTGGAACTCACATTGCAGTAGG - Intergenic
984769515 4:183425136-183425158 CATGGAATTCACATTCAAATGGG - Intergenic
986210834 5:5670376-5670398 CATGTAACTCACATGTAAGTGGG - Intergenic
990989348 5:61670017-61670039 CTTGGAACTCACATTCAAGTAGG - Intronic
991553703 5:67871823-67871845 CAAGCAACTCACAATGGAACAGG - Intergenic
996369969 5:122742773-122742795 CATGAAGCTCACATTTAAGTAGG - Intergenic
996519372 5:124409876-124409898 CATGTAAGTCACCTTGGAATTGG + Intergenic
996598790 5:125236844-125236866 TATGCAAATCACATTGATTTGGG - Intergenic
996985412 5:129556578-129556600 CAATCAACTGACCTTGAAATAGG + Intronic
997413011 5:133704473-133704495 CATTCAGCTCAGATTGAACTAGG + Intergenic
997881386 5:137594408-137594430 CATGCAAATGACATGCAAATTGG - Intronic
999537116 5:152529416-152529438 CGTGGAACTCACATTCAAGTGGG + Intergenic
1007280978 6:40712261-40712283 CATGAAACTCACAGTCCAATGGG - Intergenic
1008016280 6:46523791-46523813 CAAGAAACTAACGTTGAAATGGG - Intergenic
1010011094 6:71049478-71049500 AATGCAACTTACACTCAAATGGG - Intergenic
1010061311 6:71625916-71625938 CATGCAACTCACAATCCAATAGG - Intergenic
1010555728 6:77276410-77276432 TATGCCATTCACATTGAAAGAGG + Intergenic
1010800091 6:80165281-80165303 CAAGCTACTCACAGTCAAATAGG + Intronic
1010945055 6:81964209-81964231 CATGCTGAACACATTGAAATTGG - Intergenic
1011805881 6:91072088-91072110 CATGCAGGTCACATTGCAAGAGG - Intergenic
1011861800 6:91767239-91767261 CATGCACCTCACATTTCAGTAGG - Intergenic
1013659374 6:112279169-112279191 CATGCAAAATACATTGAAATGGG - Intergenic
1015704999 6:136078241-136078263 CATTCAGCTCTCATTGACATGGG - Intronic
1017857495 6:158363438-158363460 CCTTCAACTTACATGGAAATAGG - Intronic
1019644373 7:2121213-2121235 CCTACACCTCACATGGAAATGGG - Intronic
1020781586 7:12522949-12522971 TCTGCAACACACATGGAAATAGG - Intergenic
1021162812 7:17297958-17297980 CCTGCAAATAACATTGAAGTGGG - Intergenic
1023279678 7:38556736-38556758 CATGAAACTTACAGTGGAATTGG - Intronic
1023307922 7:38850363-38850385 CAAACAACTCAGAATGAAATTGG - Intronic
1024015875 7:45314454-45314476 CATGCAACTAATATTGAAACTGG - Intergenic
1024296664 7:47848976-47848998 CATGCTACTGGCATAGAAATAGG + Intronic
1026404038 7:70045924-70045946 CTTGCAACTCACATTATTATTGG + Intronic
1028720717 7:94027794-94027816 CAATCAACTCACCTTAAAATAGG + Intergenic
1031218559 7:118931120-118931142 CATGAAACCTACATTGAAACAGG - Intergenic
1033235731 7:139636499-139636521 GATGCAAGTCACATTGGATTAGG - Intronic
1033467685 7:141610380-141610402 AATGCAACTAATATTAAAATAGG - Intronic
1037062324 8:14529890-14529912 TATGCAATGCACTTTGAAATTGG + Intronic
1037852992 8:22347962-22347984 CATGGAACTCAAATTAAAAAGGG - Intronic
1038458972 8:27700323-27700345 CATGCAGCTCAAATTAAAAATGG + Intergenic
1038476474 8:27871928-27871950 CATGCAACAGACACTGAAAGTGG - Exonic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1044291274 8:90473255-90473277 CATCCAACTAACATTGAATTGGG + Intergenic
1044888166 8:96802393-96802415 GATGCATTTCACATTGAAAGTGG + Intronic
1045741999 8:105371957-105371979 CATGCAACTTACATTTCAAATGG + Intronic
1046159577 8:110342588-110342610 GGTGCTAATCACATTGAAATAGG + Intergenic
1048399369 8:134049615-134049637 CATAATACTCACATTAAAATGGG + Intergenic
1051061876 9:13054360-13054382 GATGAGACTAACATTGAAATTGG + Intergenic
1053462852 9:38284184-38284206 CATGCAAGTCACCTTGCAGTGGG + Intergenic
1053647067 9:40129493-40129515 CATGCATTTGTCATTGAAATTGG + Intergenic
1053758657 9:41334348-41334370 CATGCATTTGTCATTGAAATTGG - Intergenic
1054328065 9:63727452-63727474 CATGCATTTGTCATTGAAATTGG + Intergenic
1054537513 9:66246675-66246697 CATGCATTTGTCATTGAAATTGG - Intergenic
1055768112 9:79687061-79687083 CATGCAGCTCACATTTCACTGGG + Intronic
1062132880 9:134909557-134909579 CAAGAAACACACATTGAAACTGG + Intronic
1202794848 9_KI270719v1_random:112792-112814 CATGCATTTGTCATTGAAATTGG + Intergenic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1187754130 X:22501456-22501478 CATGCAATTTACATTGTATTAGG - Intergenic
1188312185 X:28630915-28630937 CATGGAGCTTACATTCAAATGGG + Intronic
1188735639 X:33711378-33711400 CGTGTAACTAACAGTGAAATAGG - Intergenic
1189609767 X:42719810-42719832 AATTCAAGTCACACTGAAATAGG + Intergenic
1190407813 X:50105018-50105040 TATGGAACTTACATTGTAATTGG - Intergenic
1192264051 X:69526565-69526587 CGTGCAACTCACATTTTAGTGGG + Intronic
1193656726 X:84207297-84207319 AATGCAGCTGACATTGAATTGGG + Intergenic
1193786369 X:85764258-85764280 CAAGCAACTAAGATTGTAATTGG + Intergenic
1195907486 X:109859474-109859496 CATGAACCTCACTCTGAAATAGG - Intergenic
1197713788 X:129691152-129691174 CATGCCACTTACATTGTATTAGG + Intergenic
1198025121 X:132697769-132697791 TATGGAGCTCACATTGAATTTGG - Intronic
1198700116 X:139387774-139387796 CCTGCAAATAACATTGCAATGGG - Intergenic
1199546967 X:149016758-149016780 CATGCCACTCCCTTTAAAATGGG + Intergenic
1199856895 X:151766641-151766663 CATGGAAATAACATTCAAATTGG + Intergenic