ID: 910676493

View in Genome Browser
Species Human (GRCh38)
Location 1:89821355-89821377
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 34}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910676493_910676504 19 Left 910676493 1:89821355-89821377 CCGCGCCGAGCCGGAGCGCGCAA 0: 1
1: 0
2: 0
3: 4
4: 34
Right 910676504 1:89821397-89821419 GCCCGAGCTGCGGTTGCGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 156
910676493_910676506 20 Left 910676493 1:89821355-89821377 CCGCGCCGAGCCGGAGCGCGCAA 0: 1
1: 0
2: 0
3: 4
4: 34
Right 910676506 1:89821398-89821420 CCCGAGCTGCGGTTGCGGCCGGG 0: 1
1: 0
2: 1
3: 5
4: 125
910676493_910676501 9 Left 910676493 1:89821355-89821377 CCGCGCCGAGCCGGAGCGCGCAA 0: 1
1: 0
2: 0
3: 4
4: 34
Right 910676501 1:89821387-89821409 AGGCGCCGCGGCCCGAGCTGCGG 0: 1
1: 0
2: 0
3: 18
4: 178
910676493_910676503 15 Left 910676493 1:89821355-89821377 CCGCGCCGAGCCGGAGCGCGCAA 0: 1
1: 0
2: 0
3: 4
4: 34
Right 910676503 1:89821393-89821415 CGCGGCCCGAGCTGCGGTTGCGG 0: 1
1: 0
2: 0
3: 5
4: 93
910676493_910676498 -3 Left 910676493 1:89821355-89821377 CCGCGCCGAGCCGGAGCGCGCAA 0: 1
1: 0
2: 0
3: 4
4: 34
Right 910676498 1:89821375-89821397 CAACCCTGGCGCAGGCGCCGCGG 0: 1
1: 0
2: 1
3: 8
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910676493 Original CRISPR TTGCGCGCTCCGGCTCGGCG CGG (reversed) Intronic