ID: 910676494

View in Genome Browser
Species Human (GRCh38)
Location 1:89821360-89821382
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 50}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910676494_910676498 -8 Left 910676494 1:89821360-89821382 CCGAGCCGGAGCGCGCAACCCTG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 910676498 1:89821375-89821397 CAACCCTGGCGCAGGCGCCGCGG 0: 1
1: 0
2: 1
3: 8
4: 159
910676494_910676501 4 Left 910676494 1:89821360-89821382 CCGAGCCGGAGCGCGCAACCCTG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 910676501 1:89821387-89821409 AGGCGCCGCGGCCCGAGCTGCGG 0: 1
1: 0
2: 0
3: 18
4: 178
910676494_910676504 14 Left 910676494 1:89821360-89821382 CCGAGCCGGAGCGCGCAACCCTG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 910676504 1:89821397-89821419 GCCCGAGCTGCGGTTGCGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 156
910676494_910676508 26 Left 910676494 1:89821360-89821382 CCGAGCCGGAGCGCGCAACCCTG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 910676508 1:89821409-89821431 GTTGCGGCCGGGAACTCATTCGG 0: 1
1: 0
2: 0
3: 0
4: 17
910676494_910676509 27 Left 910676494 1:89821360-89821382 CCGAGCCGGAGCGCGCAACCCTG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 910676509 1:89821410-89821432 TTGCGGCCGGGAACTCATTCGGG 0: 1
1: 0
2: 0
3: 5
4: 28
910676494_910676510 28 Left 910676494 1:89821360-89821382 CCGAGCCGGAGCGCGCAACCCTG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 910676510 1:89821411-89821433 TGCGGCCGGGAACTCATTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 29
910676494_910676506 15 Left 910676494 1:89821360-89821382 CCGAGCCGGAGCGCGCAACCCTG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 910676506 1:89821398-89821420 CCCGAGCTGCGGTTGCGGCCGGG 0: 1
1: 0
2: 1
3: 5
4: 125
910676494_910676503 10 Left 910676494 1:89821360-89821382 CCGAGCCGGAGCGCGCAACCCTG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 910676503 1:89821393-89821415 CGCGGCCCGAGCTGCGGTTGCGG 0: 1
1: 0
2: 0
3: 5
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910676494 Original CRISPR CAGGGTTGCGCGCTCCGGCT CGG (reversed) Intronic