ID: 910676496

View in Genome Browser
Species Human (GRCh38)
Location 1:89821365-89821387
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 29}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910676496_910676501 -1 Left 910676496 1:89821365-89821387 CCGGAGCGCGCAACCCTGGCGCA 0: 1
1: 0
2: 0
3: 3
4: 29
Right 910676501 1:89821387-89821409 AGGCGCCGCGGCCCGAGCTGCGG 0: 1
1: 0
2: 0
3: 18
4: 178
910676496_910676503 5 Left 910676496 1:89821365-89821387 CCGGAGCGCGCAACCCTGGCGCA 0: 1
1: 0
2: 0
3: 3
4: 29
Right 910676503 1:89821393-89821415 CGCGGCCCGAGCTGCGGTTGCGG 0: 1
1: 0
2: 0
3: 5
4: 93
910676496_910676504 9 Left 910676496 1:89821365-89821387 CCGGAGCGCGCAACCCTGGCGCA 0: 1
1: 0
2: 0
3: 3
4: 29
Right 910676504 1:89821397-89821419 GCCCGAGCTGCGGTTGCGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 156
910676496_910676508 21 Left 910676496 1:89821365-89821387 CCGGAGCGCGCAACCCTGGCGCA 0: 1
1: 0
2: 0
3: 3
4: 29
Right 910676508 1:89821409-89821431 GTTGCGGCCGGGAACTCATTCGG 0: 1
1: 0
2: 0
3: 0
4: 17
910676496_910676509 22 Left 910676496 1:89821365-89821387 CCGGAGCGCGCAACCCTGGCGCA 0: 1
1: 0
2: 0
3: 3
4: 29
Right 910676509 1:89821410-89821432 TTGCGGCCGGGAACTCATTCGGG 0: 1
1: 0
2: 0
3: 5
4: 28
910676496_910676510 23 Left 910676496 1:89821365-89821387 CCGGAGCGCGCAACCCTGGCGCA 0: 1
1: 0
2: 0
3: 3
4: 29
Right 910676510 1:89821411-89821433 TGCGGCCGGGAACTCATTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 29
910676496_910676506 10 Left 910676496 1:89821365-89821387 CCGGAGCGCGCAACCCTGGCGCA 0: 1
1: 0
2: 0
3: 3
4: 29
Right 910676506 1:89821398-89821420 CCCGAGCTGCGGTTGCGGCCGGG 0: 1
1: 0
2: 1
3: 5
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910676496 Original CRISPR TGCGCCAGGGTTGCGCGCTC CGG (reversed) Intronic