ID: 910676498

View in Genome Browser
Species Human (GRCh38)
Location 1:89821375-89821397
Sequence CAACCCTGGCGCAGGCGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910676493_910676498 -3 Left 910676493 1:89821355-89821377 CCGCGCCGAGCCGGAGCGCGCAA 0: 1
1: 0
2: 0
3: 4
4: 34
Right 910676498 1:89821375-89821397 CAACCCTGGCGCAGGCGCCGCGG 0: 1
1: 0
2: 1
3: 8
4: 159
910676494_910676498 -8 Left 910676494 1:89821360-89821382 CCGAGCCGGAGCGCGCAACCCTG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 910676498 1:89821375-89821397 CAACCCTGGCGCAGGCGCCGCGG 0: 1
1: 0
2: 1
3: 8
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910676498 Original CRISPR CAACCCTGGCGCAGGCGCCG CGG Intronic