ID: 910676499

View in Genome Browser
Species Human (GRCh38)
Location 1:89821378-89821400
Sequence GGGCCGCGGCGCCTGCGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 295}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910676499_910676515 21 Left 910676499 1:89821378-89821400 CCCTGGCGCAGGCGCCGCGGCCC 0: 1
1: 0
2: 3
3: 28
4: 295
Right 910676515 1:89821422-89821444 ACTCATTCGGGGACGTCCGGGGG 0: 1
1: 0
2: 0
3: 0
4: 20
910676499_910676508 8 Left 910676499 1:89821378-89821400 CCCTGGCGCAGGCGCCGCGGCCC 0: 1
1: 0
2: 3
3: 28
4: 295
Right 910676508 1:89821409-89821431 GTTGCGGCCGGGAACTCATTCGG 0: 1
1: 0
2: 0
3: 0
4: 17
910676499_910676506 -3 Left 910676499 1:89821378-89821400 CCCTGGCGCAGGCGCCGCGGCCC 0: 1
1: 0
2: 3
3: 28
4: 295
Right 910676506 1:89821398-89821420 CCCGAGCTGCGGTTGCGGCCGGG 0: 1
1: 0
2: 1
3: 5
4: 125
910676499_910676509 9 Left 910676499 1:89821378-89821400 CCCTGGCGCAGGCGCCGCGGCCC 0: 1
1: 0
2: 3
3: 28
4: 295
Right 910676509 1:89821410-89821432 TTGCGGCCGGGAACTCATTCGGG 0: 1
1: 0
2: 0
3: 5
4: 28
910676499_910676518 29 Left 910676499 1:89821378-89821400 CCCTGGCGCAGGCGCCGCGGCCC 0: 1
1: 0
2: 3
3: 28
4: 295
Right 910676518 1:89821430-89821452 GGGGACGTCCGGGGGTCGGGAGG 0: 1
1: 0
2: 2
3: 26
4: 254
910676499_910676513 19 Left 910676499 1:89821378-89821400 CCCTGGCGCAGGCGCCGCGGCCC 0: 1
1: 0
2: 3
3: 28
4: 295
Right 910676513 1:89821420-89821442 GAACTCATTCGGGGACGTCCGGG 0: 1
1: 0
2: 0
3: 3
4: 32
910676499_910676510 10 Left 910676499 1:89821378-89821400 CCCTGGCGCAGGCGCCGCGGCCC 0: 1
1: 0
2: 3
3: 28
4: 295
Right 910676510 1:89821411-89821433 TGCGGCCGGGAACTCATTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 29
910676499_910676517 26 Left 910676499 1:89821378-89821400 CCCTGGCGCAGGCGCCGCGGCCC 0: 1
1: 0
2: 3
3: 28
4: 295
Right 910676517 1:89821427-89821449 TTCGGGGACGTCCGGGGGTCGGG 0: 1
1: 0
2: 1
3: 9
4: 61
910676499_910676503 -8 Left 910676499 1:89821378-89821400 CCCTGGCGCAGGCGCCGCGGCCC 0: 1
1: 0
2: 3
3: 28
4: 295
Right 910676503 1:89821393-89821415 CGCGGCCCGAGCTGCGGTTGCGG 0: 1
1: 0
2: 0
3: 5
4: 93
910676499_910676504 -4 Left 910676499 1:89821378-89821400 CCCTGGCGCAGGCGCCGCGGCCC 0: 1
1: 0
2: 3
3: 28
4: 295
Right 910676504 1:89821397-89821419 GCCCGAGCTGCGGTTGCGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 156
910676499_910676512 18 Left 910676499 1:89821378-89821400 CCCTGGCGCAGGCGCCGCGGCCC 0: 1
1: 0
2: 3
3: 28
4: 295
Right 910676512 1:89821419-89821441 GGAACTCATTCGGGGACGTCCGG 0: 1
1: 0
2: 0
3: 1
4: 33
910676499_910676514 20 Left 910676499 1:89821378-89821400 CCCTGGCGCAGGCGCCGCGGCCC 0: 1
1: 0
2: 3
3: 28
4: 295
Right 910676514 1:89821421-89821443 AACTCATTCGGGGACGTCCGGGG 0: 1
1: 0
2: 0
3: 1
4: 18
910676499_910676516 25 Left 910676499 1:89821378-89821400 CCCTGGCGCAGGCGCCGCGGCCC 0: 1
1: 0
2: 3
3: 28
4: 295
Right 910676516 1:89821426-89821448 ATTCGGGGACGTCCGGGGGTCGG 0: 1
1: 1
2: 1
3: 3
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910676499 Original CRISPR GGGCCGCGGCGCCTGCGCCA GGG (reversed) Intronic