ID: 910676501

View in Genome Browser
Species Human (GRCh38)
Location 1:89821387-89821409
Sequence AGGCGCCGCGGCCCGAGCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
910676496_910676501 -1 Left 910676496 1:89821365-89821387 CCGGAGCGCGCAACCCTGGCGCA 0: 1
1: 0
2: 0
3: 3
4: 29
Right 910676501 1:89821387-89821409 AGGCGCCGCGGCCCGAGCTGCGG 0: 1
1: 0
2: 0
3: 18
4: 178
910676493_910676501 9 Left 910676493 1:89821355-89821377 CCGCGCCGAGCCGGAGCGCGCAA 0: 1
1: 0
2: 0
3: 4
4: 34
Right 910676501 1:89821387-89821409 AGGCGCCGCGGCCCGAGCTGCGG 0: 1
1: 0
2: 0
3: 18
4: 178
910676494_910676501 4 Left 910676494 1:89821360-89821382 CCGAGCCGGAGCGCGCAACCCTG 0: 1
1: 0
2: 0
3: 4
4: 50
Right 910676501 1:89821387-89821409 AGGCGCCGCGGCCCGAGCTGCGG 0: 1
1: 0
2: 0
3: 18
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
910676501 Original CRISPR AGGCGCCGCGGCCCGAGCTG CGG Intronic