ID: 910676501 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:89821387-89821409 |
Sequence | AGGCGCCGCGGCCCGAGCTG CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 197 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 18, 4: 178} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
910676494_910676501 | 4 | Left | 910676494 | 1:89821360-89821382 | CCGAGCCGGAGCGCGCAACCCTG | 0: 1 1: 0 2: 0 3: 4 4: 50 |
||
Right | 910676501 | 1:89821387-89821409 | AGGCGCCGCGGCCCGAGCTGCGG | 0: 1 1: 0 2: 0 3: 18 4: 178 |
||||
910676493_910676501 | 9 | Left | 910676493 | 1:89821355-89821377 | CCGCGCCGAGCCGGAGCGCGCAA | 0: 1 1: 0 2: 0 3: 4 4: 34 |
||
Right | 910676501 | 1:89821387-89821409 | AGGCGCCGCGGCCCGAGCTGCGG | 0: 1 1: 0 2: 0 3: 18 4: 178 |
||||
910676496_910676501 | -1 | Left | 910676496 | 1:89821365-89821387 | CCGGAGCGCGCAACCCTGGCGCA | 0: 1 1: 0 2: 0 3: 3 4: 29 |
||
Right | 910676501 | 1:89821387-89821409 | AGGCGCCGCGGCCCGAGCTGCGG | 0: 1 1: 0 2: 0 3: 18 4: 178 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
910676501 | Original CRISPR | AGGCGCCGCGGCCCGAGCTG CGG | Intronic | ||